Incidental Mutation 'R4222:Atm'
ID 319409
Institutional Source Beutler Lab
Gene Symbol Atm
Ensembl Gene ENSMUSG00000034218
Gene Name ataxia telangiectasia mutated
Synonyms C030026E19Rik
MMRRC Submission 041042-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.905) question?
Stock # R4222 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 53350449-53448040 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53391969 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 1807 (S1807G)
Ref Sequence ENSEMBL: ENSMUSP00000156344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000118282
AA Change: S1807G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: S1807G

DomainStartEndE-ValueType
TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232179
AA Change: S1807G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 91% (49/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 A G 17: 56,092,121 (GRCm39) Y127C probably damaging Het
Aif1l A T 2: 31,852,251 (GRCm39) S40C probably damaging Het
Alkal1 A G 1: 6,458,839 (GRCm39) K76R probably damaging Het
Bhmt-ps1 T A 4: 26,369,352 (GRCm39) noncoding transcript Het
Brd10 A T 19: 29,696,149 (GRCm39) S1115T probably benign Het
Cyp3a11 A T 5: 145,797,276 (GRCm39) Y368N probably damaging Het
Gar1 A T 3: 129,624,455 (GRCm39) probably benign Het
Gm5265 A T 1: 169,281,370 (GRCm39) noncoding transcript Het
Gm7964 T G 7: 83,406,030 (GRCm39) N281K probably damaging Het
Grin1 T C 2: 25,187,332 (GRCm39) probably benign Het
H1f5 A T 13: 21,964,147 (GRCm39) probably benign Het
Hapln4 T A 8: 70,539,610 (GRCm39) W214R probably damaging Het
Ift56 A G 6: 38,372,010 (GRCm39) Y200C probably damaging Het
Irgq C A 7: 24,233,050 (GRCm39) A297D possibly damaging Het
Kri1 T C 9: 21,192,359 (GRCm39) E145G probably benign Het
Lama3 T C 18: 12,583,460 (GRCm39) C683R probably damaging Het
Mrpl22 T A 11: 58,062,693 (GRCm39) probably benign Het
Myo7a T A 7: 97,722,436 (GRCm39) Q1163L possibly damaging Het
Nipsnap3a T A 4: 52,997,251 (GRCm39) D172E probably benign Het
Nrxn3 G T 12: 89,499,762 (GRCm39) G718* probably null Het
Olfm3 C T 3: 114,883,820 (GRCm39) Q41* probably null Het
Or52z12 A G 7: 103,233,966 (GRCm39) T246A probably damaging Het
Or8u8 G T 2: 86,012,341 (GRCm39) T38K probably damaging Het
Parm1 G A 5: 91,741,726 (GRCm39) M31I probably benign Het
Phc3 A T 3: 30,990,968 (GRCm39) S383R probably damaging Het
Pkn2 A T 3: 142,499,627 (GRCm39) L950* probably null Het
Plec C T 15: 76,061,519 (GRCm39) R2671H probably damaging Het
Ptbp1 T C 10: 79,695,047 (GRCm39) I125T probably benign Het
Ptch1 C T 13: 63,682,143 (GRCm39) R537H probably damaging Het
Ptk7 A T 17: 46,885,389 (GRCm39) M679K probably benign Het
Ptx3 C T 3: 66,132,127 (GRCm39) T216I probably damaging Het
Rrp8 T C 7: 105,383,229 (GRCm39) I346V possibly damaging Het
Rsrc1 A G 3: 66,901,900 (GRCm39) K17E unknown Het
Ryr2 T A 13: 11,752,759 (GRCm39) E1854V possibly damaging Het
Semp2l2a T C 8: 13,888,061 (GRCm39) E10G probably benign Het
Slc25a45 A T 19: 5,930,146 (GRCm39) I39F probably damaging Het
Spag5 G A 11: 78,195,337 (GRCm39) V215I probably damaging Het
Ston1 A G 17: 88,944,199 (GRCm39) Y535C probably damaging Het
Tbc1d14 A T 5: 36,650,452 (GRCm39) S395T probably benign Het
Tlr11 C T 14: 50,599,306 (GRCm39) P431S probably damaging Het
Trerf1 G T 17: 47,625,727 (GRCm39) noncoding transcript Het
Trim43b T A 9: 88,972,692 (GRCm39) Q154L probably benign Het
Vmn1r49 A G 6: 90,049,228 (GRCm39) F258S probably benign Het
Vmn1r-ps103 C A 13: 22,626,198 (GRCm39) noncoding transcript Het
Vmn2r14 A G 5: 109,364,149 (GRCm39) M589T probably benign Het
Vmn2r60 A T 7: 41,765,952 (GRCm39) T20S probably benign Het
Zbtb5 A G 4: 44,993,855 (GRCm39) probably null Het
Zfp35 T G 18: 24,136,246 (GRCm39) F197V possibly damaging Het
Other mutations in Atm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53,435,743 (GRCm39) missense probably damaging 1.00
IGL00466:Atm APN 9 53,410,412 (GRCm39) splice site probably benign
IGL00567:Atm APN 9 53,414,416 (GRCm39) nonsense probably null
IGL00702:Atm APN 9 53,423,131 (GRCm39) missense probably benign 0.02
IGL00743:Atm APN 9 53,424,416 (GRCm39) missense probably benign 0.00
IGL00771:Atm APN 9 53,404,354 (GRCm39) missense probably benign 0.01
IGL00773:Atm APN 9 53,433,444 (GRCm39) missense probably benign 0.00
IGL00819:Atm APN 9 53,429,831 (GRCm39) missense probably damaging 1.00
IGL00864:Atm APN 9 53,445,233 (GRCm39) missense probably damaging 0.99
IGL00985:Atm APN 9 53,371,116 (GRCm39) missense probably damaging 0.98
IGL01109:Atm APN 9 53,401,593 (GRCm39) missense probably damaging 1.00
IGL01120:Atm APN 9 53,372,422 (GRCm39) critical splice acceptor site probably null
IGL01369:Atm APN 9 53,426,617 (GRCm39) missense probably benign
IGL01374:Atm APN 9 53,443,024 (GRCm39) missense possibly damaging 0.58
IGL01406:Atm APN 9 53,351,046 (GRCm39) makesense probably null
IGL01409:Atm APN 9 53,410,471 (GRCm39) missense probably benign 0.01
IGL01434:Atm APN 9 53,419,107 (GRCm39) missense probably benign 0.04
IGL01486:Atm APN 9 53,421,513 (GRCm39) missense probably benign
IGL01583:Atm APN 9 53,395,547 (GRCm39) splice site probably benign
IGL01861:Atm APN 9 53,405,912 (GRCm39) missense probably null 0.89
IGL01865:Atm APN 9 53,372,302 (GRCm39) missense probably damaging 1.00
IGL02026:Atm APN 9 53,353,717 (GRCm39) splice site probably null
IGL02072:Atm APN 9 53,371,096 (GRCm39) missense probably benign 0.01
IGL02075:Atm APN 9 53,438,537 (GRCm39) missense probably damaging 1.00
IGL02127:Atm APN 9 53,399,283 (GRCm39) missense probably damaging 1.00
IGL02175:Atm APN 9 53,391,965 (GRCm39) missense probably damaging 0.99
IGL02246:Atm APN 9 53,438,485 (GRCm39) missense probably benign 0.12
IGL02259:Atm APN 9 53,429,794 (GRCm39) splice site probably benign
IGL02351:Atm APN 9 53,433,476 (GRCm39) missense probably benign 0.04
IGL02358:Atm APN 9 53,433,476 (GRCm39) missense probably benign 0.04
IGL02387:Atm APN 9 53,391,066 (GRCm39) splice site probably null
IGL02417:Atm APN 9 53,390,995 (GRCm39) missense probably benign 0.00
IGL02422:Atm APN 9 53,412,092 (GRCm39) missense probably damaging 1.00
IGL02445:Atm APN 9 53,365,630 (GRCm39) missense probably benign 0.00
IGL02492:Atm APN 9 53,367,159 (GRCm39) missense probably damaging 0.99
IGL02513:Atm APN 9 53,408,562 (GRCm39) splice site probably benign
IGL02633:Atm APN 9 53,359,453 (GRCm39) missense probably damaging 1.00
IGL02634:Atm APN 9 53,427,863 (GRCm39) missense probably benign 0.00
IGL02948:Atm APN 9 53,364,740 (GRCm39) splice site probably benign
IGL02959:Atm APN 9 53,382,718 (GRCm39) missense probably damaging 1.00
IGL02965:Atm APN 9 53,364,863 (GRCm39) missense probably damaging 1.00
IGL03085:Atm APN 9 53,395,471 (GRCm39) missense possibly damaging 0.89
antebellum UTSW 9 53,429,859 (GRCm39) nonsense probably null
bull_run UTSW 9 53,399,222 (GRCm39) missense probably benign 0.09
Civil UTSW 9 53,403,568 (GRCm39) missense possibly damaging 0.78
gettysburg UTSW 9 53,367,288 (GRCm39) splice site probably null
Grant UTSW 9 53,423,217 (GRCm39) nonsense probably null
Indicative UTSW 9 53,356,676 (GRCm39) splice site probably null
Marker UTSW 9 53,365,579 (GRCm39) splice site probably benign
maunder UTSW 9 53,410,497 (GRCm39) nonsense probably null
mockingbird UTSW 9 53,427,767 (GRCm39) nonsense probably null
mockingbird2 UTSW 9 53,399,887 (GRCm39) missense probably damaging 1.00
osphere UTSW 9 53,390,973 (GRCm39) missense probably damaging 0.99
shiloh UTSW 9 53,376,598 (GRCm39) missense probably damaging 1.00
Strato UTSW 9 53,414,318 (GRCm39) missense probably damaging 1.00
thrasher UTSW 9 53,356,807 (GRCm39) missense probably benign 0.01
Tropo UTSW 9 53,442,948 (GRCm39) missense probably damaging 1.00
P0019:Atm UTSW 9 53,376,328 (GRCm39) splice site probably benign
PIT4403001:Atm UTSW 9 53,412,282 (GRCm39) missense probably benign
PIT4687001:Atm UTSW 9 53,398,112 (GRCm39) critical splice donor site probably null
R0004:Atm UTSW 9 53,364,828 (GRCm39) splice site probably benign
R0035:Atm UTSW 9 53,424,480 (GRCm39) missense probably benign 0.01
R0098:Atm UTSW 9 53,429,869 (GRCm39) missense probably benign 0.10
R0098:Atm UTSW 9 53,429,869 (GRCm39) missense probably benign 0.10
R0201:Atm UTSW 9 53,365,579 (GRCm39) splice site probably benign
R0304:Atm UTSW 9 53,427,644 (GRCm39) missense probably benign 0.34
R0308:Atm UTSW 9 53,365,773 (GRCm39) splice site probably null
R0362:Atm UTSW 9 53,370,138 (GRCm39) missense possibly damaging 0.90
R0470:Atm UTSW 9 53,372,266 (GRCm39) missense probably damaging 1.00
R0513:Atm UTSW 9 53,415,248 (GRCm39) missense probably benign 0.00
R0589:Atm UTSW 9 53,401,492 (GRCm39) missense possibly damaging 0.51
R0617:Atm UTSW 9 53,370,241 (GRCm39) nonsense probably null
R0630:Atm UTSW 9 53,442,922 (GRCm39) splice site probably benign
R0652:Atm UTSW 9 53,397,314 (GRCm39) missense probably damaging 0.98
R0698:Atm UTSW 9 53,426,539 (GRCm39) missense probably damaging 1.00
R0737:Atm UTSW 9 53,367,866 (GRCm39) missense probably damaging 1.00
R0885:Atm UTSW 9 53,371,123 (GRCm39) missense probably benign
R0947:Atm UTSW 9 53,415,392 (GRCm39) missense probably benign 0.01
R0948:Atm UTSW 9 53,407,258 (GRCm39) missense probably benign
R1144:Atm UTSW 9 53,422,998 (GRCm39) splice site probably benign
R1252:Atm UTSW 9 53,367,140 (GRCm39) missense probably damaging 1.00
R1295:Atm UTSW 9 53,367,830 (GRCm39) missense probably damaging 1.00
R1296:Atm UTSW 9 53,367,830 (GRCm39) missense probably damaging 1.00
R1419:Atm UTSW 9 53,368,789 (GRCm39) missense probably benign 0.00
R1477:Atm UTSW 9 53,375,573 (GRCm39) missense probably benign 0.00
R1596:Atm UTSW 9 53,364,678 (GRCm39) missense probably damaging 1.00
R1630:Atm UTSW 9 53,390,973 (GRCm39) missense probably damaging 0.99
R1667:Atm UTSW 9 53,412,232 (GRCm39) missense probably damaging 1.00
R1681:Atm UTSW 9 53,433,455 (GRCm39) missense possibly damaging 0.94
R1703:Atm UTSW 9 53,412,000 (GRCm39) missense probably benign
R1817:Atm UTSW 9 53,403,533 (GRCm39) splice site probably benign
R1840:Atm UTSW 9 53,367,830 (GRCm39) missense probably damaging 1.00
R1848:Atm UTSW 9 53,379,312 (GRCm39) missense probably benign 0.06
R1906:Atm UTSW 9 53,417,868 (GRCm39) missense probably damaging 1.00
R1958:Atm UTSW 9 53,382,718 (GRCm39) missense probably damaging 1.00
R2108:Atm UTSW 9 53,355,297 (GRCm39) missense probably damaging 1.00
R2116:Atm UTSW 9 53,412,269 (GRCm39) missense probably benign 0.36
R2134:Atm UTSW 9 53,379,264 (GRCm39) critical splice donor site probably null
R2137:Atm UTSW 9 53,364,675 (GRCm39) missense probably damaging 1.00
R2291:Atm UTSW 9 53,402,209 (GRCm39) splice site probably null
R2348:Atm UTSW 9 53,403,568 (GRCm39) missense possibly damaging 0.78
R2483:Atm UTSW 9 53,421,566 (GRCm39) missense probably damaging 1.00
R2567:Atm UTSW 9 53,368,770 (GRCm39) missense possibly damaging 0.72
R2897:Atm UTSW 9 53,419,105 (GRCm39) missense probably damaging 0.99
R2939:Atm UTSW 9 53,406,011 (GRCm39) missense probably damaging 1.00
R3008:Atm UTSW 9 53,392,050 (GRCm39) missense probably benign 0.00
R3236:Atm UTSW 9 53,391,048 (GRCm39) missense probably benign 0.15
R3847:Atm UTSW 9 53,414,375 (GRCm39) missense possibly damaging 0.94
R3889:Atm UTSW 9 53,417,936 (GRCm39) splice site probably benign
R3919:Atm UTSW 9 53,403,578 (GRCm39) missense probably benign 0.00
R4125:Atm UTSW 9 53,361,921 (GRCm39) missense probably damaging 1.00
R4395:Atm UTSW 9 53,376,527 (GRCm39) missense probably benign 0.09
R4466:Atm UTSW 9 53,359,469 (GRCm39) nonsense probably null
R4502:Atm UTSW 9 53,407,246 (GRCm39) missense possibly damaging 0.92
R4514:Atm UTSW 9 53,404,339 (GRCm39) missense probably damaging 0.99
R4528:Atm UTSW 9 53,412,059 (GRCm39) missense probably benign 0.39
R4593:Atm UTSW 9 53,364,894 (GRCm39) missense possibly damaging 0.55
R4627:Atm UTSW 9 53,367,806 (GRCm39) missense possibly damaging 0.79
R4634:Atm UTSW 9 53,443,033 (GRCm39) missense probably benign 0.01
R4665:Atm UTSW 9 53,375,529 (GRCm39) missense probably benign 0.00
R4672:Atm UTSW 9 53,433,501 (GRCm39) missense probably damaging 0.99
R4741:Atm UTSW 9 53,364,907 (GRCm39) missense probably benign 0.10
R4808:Atm UTSW 9 53,356,795 (GRCm39) missense probably damaging 0.99
R4959:Atm UTSW 9 53,426,601 (GRCm39) missense probably benign
R4996:Atm UTSW 9 53,435,807 (GRCm39) missense probably benign 0.09
R5030:Atm UTSW 9 53,431,409 (GRCm39) nonsense probably null
R5214:Atm UTSW 9 53,402,327 (GRCm39) missense probably benign 0.09
R5260:Atm UTSW 9 53,417,911 (GRCm39) missense probably damaging 0.99
R5311:Atm UTSW 9 53,429,923 (GRCm39) missense probably benign 0.00
R5394:Atm UTSW 9 53,419,077 (GRCm39) critical splice donor site probably null
R5400:Atm UTSW 9 53,414,318 (GRCm39) missense probably damaging 1.00
R5436:Atm UTSW 9 53,371,104 (GRCm39) missense probably benign 0.00
R5441:Atm UTSW 9 53,427,767 (GRCm39) nonsense probably null
R5569:Atm UTSW 9 53,427,750 (GRCm39) nonsense probably null
R5856:Atm UTSW 9 53,407,255 (GRCm39) missense possibly damaging 0.64
R5891:Atm UTSW 9 53,408,459 (GRCm39) missense probably benign
R5910:Atm UTSW 9 53,359,380 (GRCm39) missense probably damaging 0.96
R6054:Atm UTSW 9 53,371,173 (GRCm39) missense probably damaging 1.00
R6062:Atm UTSW 9 53,399,887 (GRCm39) missense probably damaging 1.00
R6092:Atm UTSW 9 53,435,714 (GRCm39) missense probably damaging 1.00
R6127:Atm UTSW 9 53,435,809 (GRCm39) missense probably damaging 1.00
R6160:Atm UTSW 9 53,402,259 (GRCm39) missense probably benign 0.04
R6267:Atm UTSW 9 53,355,300 (GRCm39) missense probably damaging 1.00
R6273:Atm UTSW 9 53,399,222 (GRCm39) missense probably benign 0.09
R6284:Atm UTSW 9 53,356,676 (GRCm39) splice site probably null
R6478:Atm UTSW 9 53,401,554 (GRCm39) missense probably damaging 1.00
R6547:Atm UTSW 9 53,351,457 (GRCm39) missense probably damaging 1.00
R6549:Atm UTSW 9 53,404,477 (GRCm39) missense probably benign 0.00
R6704:Atm UTSW 9 53,370,153 (GRCm39) missense probably benign 0.02
R6715:Atm UTSW 9 53,442,948 (GRCm39) missense probably damaging 1.00
R6737:Atm UTSW 9 53,397,351 (GRCm39) missense probably benign 0.30
R6759:Atm UTSW 9 53,429,859 (GRCm39) nonsense probably null
R6766:Atm UTSW 9 53,401,582 (GRCm39) missense probably damaging 0.99
R6813:Atm UTSW 9 53,408,535 (GRCm39) missense probably benign 0.00
R6852:Atm UTSW 9 53,393,730 (GRCm39) missense possibly damaging 0.93
R7064:Atm UTSW 9 53,419,181 (GRCm39) missense probably benign 0.02
R7208:Atm UTSW 9 53,423,308 (GRCm39) splice site probably null
R7211:Atm UTSW 9 53,399,860 (GRCm39) missense probably benign 0.01
R7220:Atm UTSW 9 53,423,217 (GRCm39) nonsense probably null
R7336:Atm UTSW 9 53,373,803 (GRCm39) missense possibly damaging 0.47
R7363:Atm UTSW 9 53,376,598 (GRCm39) missense probably damaging 1.00
R7378:Atm UTSW 9 53,364,737 (GRCm39) critical splice acceptor site probably null
R7472:Atm UTSW 9 53,359,425 (GRCm39) missense possibly damaging 0.81
R7487:Atm UTSW 9 53,435,654 (GRCm39) missense probably benign
R7497:Atm UTSW 9 53,423,191 (GRCm39) missense probably benign 0.00
R7584:Atm UTSW 9 53,424,427 (GRCm39) missense probably damaging 0.99
R7624:Atm UTSW 9 53,366,068 (GRCm39) missense probably damaging 0.99
R7653:Atm UTSW 9 53,401,602 (GRCm39) nonsense probably null
R7660:Atm UTSW 9 53,356,807 (GRCm39) missense probably benign 0.01
R7679:Atm UTSW 9 53,353,797 (GRCm39) missense probably damaging 1.00
R7720:Atm UTSW 9 53,433,539 (GRCm39) missense possibly damaging 0.54
R8221:Atm UTSW 9 53,367,288 (GRCm39) splice site probably null
R8247:Atm UTSW 9 53,361,870 (GRCm39) missense
R8334:Atm UTSW 9 53,433,573 (GRCm39) missense probably benign 0.00
R8503:Atm UTSW 9 53,399,352 (GRCm39) missense probably damaging 0.99
R8552:Atm UTSW 9 53,435,797 (GRCm39) missense probably damaging 1.00
R8749:Atm UTSW 9 53,410,497 (GRCm39) nonsense probably null
R8838:Atm UTSW 9 53,427,851 (GRCm39) missense probably damaging 0.99
R9126:Atm UTSW 9 53,370,134 (GRCm39) missense probably benign 0.01
R9131:Atm UTSW 9 53,445,044 (GRCm39) missense probably benign 0.10
R9191:Atm UTSW 9 53,438,590 (GRCm39) missense probably benign 0.29
R9257:Atm UTSW 9 53,407,150 (GRCm39) critical splice donor site probably null
R9473:Atm UTSW 9 53,410,272 (GRCm39) missense probably benign
R9558:Atm UTSW 9 53,412,081 (GRCm39) missense probably benign 0.00
R9598:Atm UTSW 9 53,431,381 (GRCm39) missense probably benign 0.34
R9717:Atm UTSW 9 53,427,817 (GRCm39) missense probably damaging 1.00
R9794:Atm UTSW 9 53,429,867 (GRCm39) missense probably benign
X0067:Atm UTSW 9 53,390,994 (GRCm39) missense probably benign 0.00
Z1088:Atm UTSW 9 53,442,987 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGGTGGATGGTTTACTC -3'
(R):5'- CCAGGTGTAGTTTAAGTGCACTC -3'

Sequencing Primer
(F):5'- GTGGATGGTTTACTCATCATTTAGAG -3'
(R):5'- GTGCACTCAATTTTATTGGAAGCAG -3'
Posted On 2015-06-10