Incidental Mutation 'R4514:Atm'
ID 500641
Institutional Source Beutler Lab
Gene Symbol Atm
Ensembl Gene ENSMUSG00000034218
Gene Name ataxia telangiectasia mutated
Synonyms C030026E19Rik
MMRRC Submission 041588-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.905) question?
Stock # R4514 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 53350449-53448040 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 53404339 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 1334 (Q1334L)
Ref Sequence ENSEMBL: ENSMUSP00000156344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000118282
AA Change: Q1334L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: Q1334L

DomainStartEndE-ValueType
TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000232179
AA Change: Q1334L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam5 T G 8: 25,308,152 (GRCm39) T51P probably damaging Het
Akr1c20 A C 13: 4,557,843 (GRCm39) V201G probably damaging Het
Alg9 C T 9: 50,716,654 (GRCm39) T409M possibly damaging Het
Arpp21 T A 9: 112,006,745 (GRCm39) T155S probably damaging Het
Bptf G A 11: 106,968,518 (GRCm39) T1055M probably damaging Het
Cd3g C A 9: 44,884,882 (GRCm39) A121S possibly damaging Het
Cenpn A G 8: 117,660,135 (GRCm39) Y68C probably damaging Het
Clock A G 5: 76,378,046 (GRCm39) I618T probably benign Het
Cp A G 3: 20,042,177 (GRCm39) M982V probably damaging Het
Csf3r T A 4: 125,933,653 (GRCm39) S611T possibly damaging Het
Csn3 A G 5: 88,077,997 (GRCm39) T168A unknown Het
Cylc2 C G 4: 51,229,651 (GRCm39) T331R unknown Het
D630003M21Rik T C 2: 158,046,722 (GRCm39) T752A probably benign Het
Defb34 A T 8: 19,176,522 (GRCm39) D71V probably damaging Het
Dync1h1 T A 12: 110,623,573 (GRCm39) D3615E possibly damaging Het
Etl4 A T 2: 20,666,709 (GRCm39) T167S probably damaging Het
F5 T A 1: 163,979,566 (GRCm39) probably benign Het
Got1l1 C T 8: 27,688,513 (GRCm39) M279I probably benign Het
Grm7 A G 6: 111,335,265 (GRCm39) T559A possibly damaging Het
Ifit1 A T 19: 34,625,913 (GRCm39) R350* probably null Het
Ighv2-5 T C 12: 113,649,216 (GRCm39) N79S possibly damaging Het
Igkv17-127 A G 6: 67,838,498 (GRCm39) I70V possibly damaging Het
Itga8 T C 2: 12,187,547 (GRCm39) S711G probably benign Het
Kndc1 A G 7: 139,490,202 (GRCm39) T235A probably benign Het
Lct T C 1: 128,228,251 (GRCm39) I1081V probably benign Het
Lrrc8b G T 5: 105,627,819 (GRCm39) C55F probably damaging Het
Lrwd1 T C 5: 136,160,402 (GRCm39) T311A probably benign Het
Mapk14 T C 17: 28,943,798 (GRCm39) F129S probably damaging Het
Mdga2 A G 12: 66,763,496 (GRCm39) I200T probably damaging Het
Mocos T A 18: 24,816,269 (GRCm39) S615R probably damaging Het
Myh4 T C 11: 67,146,395 (GRCm39) V1456A probably benign Het
Myh9 T C 15: 77,648,200 (GRCm39) I1759V probably benign Het
Nat8f5 G A 6: 85,794,405 (GRCm39) T185I possibly damaging Het
Nav3 T C 10: 109,529,943 (GRCm39) I2133V possibly damaging Het
Ncam2 T A 16: 81,309,884 (GRCm39) M458K probably benign Het
Nphp1 T C 2: 127,590,007 (GRCm39) S532G probably benign Het
Oplah A G 15: 76,182,155 (GRCm39) L1035P probably damaging Het
Or4p22 T C 2: 88,317,709 (GRCm39) V211A probably benign Het
Or52h2 C T 7: 103,838,598 (GRCm39) R272H probably benign Het
Pask T A 1: 93,249,855 (GRCm39) Q515L probably benign Het
Poglut1 A T 16: 38,369,778 (GRCm39) F35I probably benign Het
Ppp1ca T G 19: 4,245,054 (GRCm39) I319S probably benign Het
Psg25 T A 7: 18,263,533 (GRCm39) R97* probably null Het
Sars2 T C 7: 28,441,709 (GRCm39) probably null Het
Slc15a4 A G 5: 127,681,600 (GRCm39) probably null Het
Slc16a7 T G 10: 125,069,308 (GRCm39) probably null Het
Slc7a8 C G 14: 54,973,247 (GRCm39) G240A possibly damaging Het
St6gal2 A T 17: 55,790,018 (GRCm39) N351Y probably benign Het
Susd5 T C 9: 113,924,992 (GRCm39) F292L probably benign Het
Tmco5 T A 2: 116,710,795 (GRCm39) D38E probably damaging Het
Tubgcp2 G A 7: 139,575,984 (GRCm39) P893L possibly damaging Het
Uncx A G 5: 139,532,522 (GRCm39) I196V possibly damaging Het
Zeb1 G A 18: 5,759,007 (GRCm39) C138Y probably damaging Het
Zfp609 A G 9: 65,610,977 (GRCm39) I662T possibly damaging Het
Zfp985 G A 4: 147,668,020 (GRCm39) C296Y probably damaging Het
Other mutations in Atm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53,435,743 (GRCm39) missense probably damaging 1.00
IGL00466:Atm APN 9 53,410,412 (GRCm39) splice site probably benign
IGL00567:Atm APN 9 53,414,416 (GRCm39) nonsense probably null
IGL00702:Atm APN 9 53,423,131 (GRCm39) missense probably benign 0.02
IGL00743:Atm APN 9 53,424,416 (GRCm39) missense probably benign 0.00
IGL00771:Atm APN 9 53,404,354 (GRCm39) missense probably benign 0.01
IGL00773:Atm APN 9 53,433,444 (GRCm39) missense probably benign 0.00
IGL00819:Atm APN 9 53,429,831 (GRCm39) missense probably damaging 1.00
IGL00864:Atm APN 9 53,445,233 (GRCm39) missense probably damaging 0.99
IGL00985:Atm APN 9 53,371,116 (GRCm39) missense probably damaging 0.98
IGL01109:Atm APN 9 53,401,593 (GRCm39) missense probably damaging 1.00
IGL01120:Atm APN 9 53,372,422 (GRCm39) critical splice acceptor site probably null
IGL01369:Atm APN 9 53,426,617 (GRCm39) missense probably benign
IGL01374:Atm APN 9 53,443,024 (GRCm39) missense possibly damaging 0.58
IGL01406:Atm APN 9 53,351,046 (GRCm39) makesense probably null
IGL01409:Atm APN 9 53,410,471 (GRCm39) missense probably benign 0.01
IGL01434:Atm APN 9 53,419,107 (GRCm39) missense probably benign 0.04
IGL01486:Atm APN 9 53,421,513 (GRCm39) missense probably benign
IGL01583:Atm APN 9 53,395,547 (GRCm39) splice site probably benign
IGL01861:Atm APN 9 53,405,912 (GRCm39) missense probably null 0.89
IGL01865:Atm APN 9 53,372,302 (GRCm39) missense probably damaging 1.00
IGL02026:Atm APN 9 53,353,717 (GRCm39) splice site probably null
IGL02072:Atm APN 9 53,371,096 (GRCm39) missense probably benign 0.01
IGL02075:Atm APN 9 53,438,537 (GRCm39) missense probably damaging 1.00
IGL02127:Atm APN 9 53,399,283 (GRCm39) missense probably damaging 1.00
IGL02175:Atm APN 9 53,391,965 (GRCm39) missense probably damaging 0.99
IGL02246:Atm APN 9 53,438,485 (GRCm39) missense probably benign 0.12
IGL02259:Atm APN 9 53,429,794 (GRCm39) splice site probably benign
IGL02351:Atm APN 9 53,433,476 (GRCm39) missense probably benign 0.04
IGL02358:Atm APN 9 53,433,476 (GRCm39) missense probably benign 0.04
IGL02387:Atm APN 9 53,391,066 (GRCm39) splice site probably null
IGL02417:Atm APN 9 53,390,995 (GRCm39) missense probably benign 0.00
IGL02422:Atm APN 9 53,412,092 (GRCm39) missense probably damaging 1.00
IGL02445:Atm APN 9 53,365,630 (GRCm39) missense probably benign 0.00
IGL02492:Atm APN 9 53,367,159 (GRCm39) missense probably damaging 0.99
IGL02513:Atm APN 9 53,408,562 (GRCm39) splice site probably benign
IGL02633:Atm APN 9 53,359,453 (GRCm39) missense probably damaging 1.00
IGL02634:Atm APN 9 53,427,863 (GRCm39) missense probably benign 0.00
IGL02948:Atm APN 9 53,364,740 (GRCm39) splice site probably benign
IGL02959:Atm APN 9 53,382,718 (GRCm39) missense probably damaging 1.00
IGL02965:Atm APN 9 53,364,863 (GRCm39) missense probably damaging 1.00
IGL03085:Atm APN 9 53,395,471 (GRCm39) missense possibly damaging 0.89
antebellum UTSW 9 53,429,859 (GRCm39) nonsense probably null
bull_run UTSW 9 53,399,222 (GRCm39) missense probably benign 0.09
Civil UTSW 9 53,403,568 (GRCm39) missense possibly damaging 0.78
gettysburg UTSW 9 53,367,288 (GRCm39) splice site probably null
Grant UTSW 9 53,423,217 (GRCm39) nonsense probably null
Indicative UTSW 9 53,356,676 (GRCm39) splice site probably null
Marker UTSW 9 53,365,579 (GRCm39) splice site probably benign
maunder UTSW 9 53,410,497 (GRCm39) nonsense probably null
mockingbird UTSW 9 53,427,767 (GRCm39) nonsense probably null
mockingbird2 UTSW 9 53,399,887 (GRCm39) missense probably damaging 1.00
osphere UTSW 9 53,390,973 (GRCm39) missense probably damaging 0.99
shiloh UTSW 9 53,376,598 (GRCm39) missense probably damaging 1.00
Strato UTSW 9 53,414,318 (GRCm39) missense probably damaging 1.00
thrasher UTSW 9 53,356,807 (GRCm39) missense probably benign 0.01
Tropo UTSW 9 53,442,948 (GRCm39) missense probably damaging 1.00
P0019:Atm UTSW 9 53,376,328 (GRCm39) splice site probably benign
PIT4403001:Atm UTSW 9 53,412,282 (GRCm39) missense probably benign
PIT4687001:Atm UTSW 9 53,398,112 (GRCm39) critical splice donor site probably null
R0004:Atm UTSW 9 53,364,828 (GRCm39) splice site probably benign
R0035:Atm UTSW 9 53,424,480 (GRCm39) missense probably benign 0.01
R0098:Atm UTSW 9 53,429,869 (GRCm39) missense probably benign 0.10
R0098:Atm UTSW 9 53,429,869 (GRCm39) missense probably benign 0.10
R0201:Atm UTSW 9 53,365,579 (GRCm39) splice site probably benign
R0304:Atm UTSW 9 53,427,644 (GRCm39) missense probably benign 0.34
R0308:Atm UTSW 9 53,365,773 (GRCm39) splice site probably null
R0362:Atm UTSW 9 53,370,138 (GRCm39) missense possibly damaging 0.90
R0470:Atm UTSW 9 53,372,266 (GRCm39) missense probably damaging 1.00
R0513:Atm UTSW 9 53,415,248 (GRCm39) missense probably benign 0.00
R0589:Atm UTSW 9 53,401,492 (GRCm39) missense possibly damaging 0.51
R0617:Atm UTSW 9 53,370,241 (GRCm39) nonsense probably null
R0630:Atm UTSW 9 53,442,922 (GRCm39) splice site probably benign
R0652:Atm UTSW 9 53,397,314 (GRCm39) missense probably damaging 0.98
R0698:Atm UTSW 9 53,426,539 (GRCm39) missense probably damaging 1.00
R0737:Atm UTSW 9 53,367,866 (GRCm39) missense probably damaging 1.00
R0885:Atm UTSW 9 53,371,123 (GRCm39) missense probably benign
R0947:Atm UTSW 9 53,415,392 (GRCm39) missense probably benign 0.01
R0948:Atm UTSW 9 53,407,258 (GRCm39) missense probably benign
R1144:Atm UTSW 9 53,422,998 (GRCm39) splice site probably benign
R1252:Atm UTSW 9 53,367,140 (GRCm39) missense probably damaging 1.00
R1295:Atm UTSW 9 53,367,830 (GRCm39) missense probably damaging 1.00
R1296:Atm UTSW 9 53,367,830 (GRCm39) missense probably damaging 1.00
R1419:Atm UTSW 9 53,368,789 (GRCm39) missense probably benign 0.00
R1477:Atm UTSW 9 53,375,573 (GRCm39) missense probably benign 0.00
R1596:Atm UTSW 9 53,364,678 (GRCm39) missense probably damaging 1.00
R1630:Atm UTSW 9 53,390,973 (GRCm39) missense probably damaging 0.99
R1667:Atm UTSW 9 53,412,232 (GRCm39) missense probably damaging 1.00
R1681:Atm UTSW 9 53,433,455 (GRCm39) missense possibly damaging 0.94
R1703:Atm UTSW 9 53,412,000 (GRCm39) missense probably benign
R1817:Atm UTSW 9 53,403,533 (GRCm39) splice site probably benign
R1840:Atm UTSW 9 53,367,830 (GRCm39) missense probably damaging 1.00
R1848:Atm UTSW 9 53,379,312 (GRCm39) missense probably benign 0.06
R1906:Atm UTSW 9 53,417,868 (GRCm39) missense probably damaging 1.00
R1958:Atm UTSW 9 53,382,718 (GRCm39) missense probably damaging 1.00
R2108:Atm UTSW 9 53,355,297 (GRCm39) missense probably damaging 1.00
R2116:Atm UTSW 9 53,412,269 (GRCm39) missense probably benign 0.36
R2134:Atm UTSW 9 53,379,264 (GRCm39) critical splice donor site probably null
R2137:Atm UTSW 9 53,364,675 (GRCm39) missense probably damaging 1.00
R2291:Atm UTSW 9 53,402,209 (GRCm39) splice site probably null
R2348:Atm UTSW 9 53,403,568 (GRCm39) missense possibly damaging 0.78
R2483:Atm UTSW 9 53,421,566 (GRCm39) missense probably damaging 1.00
R2567:Atm UTSW 9 53,368,770 (GRCm39) missense possibly damaging 0.72
R2897:Atm UTSW 9 53,419,105 (GRCm39) missense probably damaging 0.99
R2939:Atm UTSW 9 53,406,011 (GRCm39) missense probably damaging 1.00
R3008:Atm UTSW 9 53,392,050 (GRCm39) missense probably benign 0.00
R3236:Atm UTSW 9 53,391,048 (GRCm39) missense probably benign 0.15
R3847:Atm UTSW 9 53,414,375 (GRCm39) missense possibly damaging 0.94
R3889:Atm UTSW 9 53,417,936 (GRCm39) splice site probably benign
R3919:Atm UTSW 9 53,403,578 (GRCm39) missense probably benign 0.00
R4125:Atm UTSW 9 53,361,921 (GRCm39) missense probably damaging 1.00
R4222:Atm UTSW 9 53,391,969 (GRCm39) missense probably benign
R4395:Atm UTSW 9 53,376,527 (GRCm39) missense probably benign 0.09
R4466:Atm UTSW 9 53,359,469 (GRCm39) nonsense probably null
R4502:Atm UTSW 9 53,407,246 (GRCm39) missense possibly damaging 0.92
R4528:Atm UTSW 9 53,412,059 (GRCm39) missense probably benign 0.39
R4593:Atm UTSW 9 53,364,894 (GRCm39) missense possibly damaging 0.55
R4627:Atm UTSW 9 53,367,806 (GRCm39) missense possibly damaging 0.79
R4634:Atm UTSW 9 53,443,033 (GRCm39) missense probably benign 0.01
R4665:Atm UTSW 9 53,375,529 (GRCm39) missense probably benign 0.00
R4672:Atm UTSW 9 53,433,501 (GRCm39) missense probably damaging 0.99
R4741:Atm UTSW 9 53,364,907 (GRCm39) missense probably benign 0.10
R4808:Atm UTSW 9 53,356,795 (GRCm39) missense probably damaging 0.99
R4959:Atm UTSW 9 53,426,601 (GRCm39) missense probably benign
R4996:Atm UTSW 9 53,435,807 (GRCm39) missense probably benign 0.09
R5030:Atm UTSW 9 53,431,409 (GRCm39) nonsense probably null
R5214:Atm UTSW 9 53,402,327 (GRCm39) missense probably benign 0.09
R5260:Atm UTSW 9 53,417,911 (GRCm39) missense probably damaging 0.99
R5311:Atm UTSW 9 53,429,923 (GRCm39) missense probably benign 0.00
R5394:Atm UTSW 9 53,419,077 (GRCm39) critical splice donor site probably null
R5400:Atm UTSW 9 53,414,318 (GRCm39) missense probably damaging 1.00
R5436:Atm UTSW 9 53,371,104 (GRCm39) missense probably benign 0.00
R5441:Atm UTSW 9 53,427,767 (GRCm39) nonsense probably null
R5569:Atm UTSW 9 53,427,750 (GRCm39) nonsense probably null
R5856:Atm UTSW 9 53,407,255 (GRCm39) missense possibly damaging 0.64
R5891:Atm UTSW 9 53,408,459 (GRCm39) missense probably benign
R5910:Atm UTSW 9 53,359,380 (GRCm39) missense probably damaging 0.96
R6054:Atm UTSW 9 53,371,173 (GRCm39) missense probably damaging 1.00
R6062:Atm UTSW 9 53,399,887 (GRCm39) missense probably damaging 1.00
R6092:Atm UTSW 9 53,435,714 (GRCm39) missense probably damaging 1.00
R6127:Atm UTSW 9 53,435,809 (GRCm39) missense probably damaging 1.00
R6160:Atm UTSW 9 53,402,259 (GRCm39) missense probably benign 0.04
R6267:Atm UTSW 9 53,355,300 (GRCm39) missense probably damaging 1.00
R6273:Atm UTSW 9 53,399,222 (GRCm39) missense probably benign 0.09
R6284:Atm UTSW 9 53,356,676 (GRCm39) splice site probably null
R6478:Atm UTSW 9 53,401,554 (GRCm39) missense probably damaging 1.00
R6547:Atm UTSW 9 53,351,457 (GRCm39) missense probably damaging 1.00
R6549:Atm UTSW 9 53,404,477 (GRCm39) missense probably benign 0.00
R6704:Atm UTSW 9 53,370,153 (GRCm39) missense probably benign 0.02
R6715:Atm UTSW 9 53,442,948 (GRCm39) missense probably damaging 1.00
R6737:Atm UTSW 9 53,397,351 (GRCm39) missense probably benign 0.30
R6759:Atm UTSW 9 53,429,859 (GRCm39) nonsense probably null
R6766:Atm UTSW 9 53,401,582 (GRCm39) missense probably damaging 0.99
R6813:Atm UTSW 9 53,408,535 (GRCm39) missense probably benign 0.00
R6852:Atm UTSW 9 53,393,730 (GRCm39) missense possibly damaging 0.93
R7064:Atm UTSW 9 53,419,181 (GRCm39) missense probably benign 0.02
R7208:Atm UTSW 9 53,423,308 (GRCm39) splice site probably null
R7211:Atm UTSW 9 53,399,860 (GRCm39) missense probably benign 0.01
R7220:Atm UTSW 9 53,423,217 (GRCm39) nonsense probably null
R7336:Atm UTSW 9 53,373,803 (GRCm39) missense possibly damaging 0.47
R7363:Atm UTSW 9 53,376,598 (GRCm39) missense probably damaging 1.00
R7378:Atm UTSW 9 53,364,737 (GRCm39) critical splice acceptor site probably null
R7472:Atm UTSW 9 53,359,425 (GRCm39) missense possibly damaging 0.81
R7487:Atm UTSW 9 53,435,654 (GRCm39) missense probably benign
R7497:Atm UTSW 9 53,423,191 (GRCm39) missense probably benign 0.00
R7584:Atm UTSW 9 53,424,427 (GRCm39) missense probably damaging 0.99
R7624:Atm UTSW 9 53,366,068 (GRCm39) missense probably damaging 0.99
R7653:Atm UTSW 9 53,401,602 (GRCm39) nonsense probably null
R7660:Atm UTSW 9 53,356,807 (GRCm39) missense probably benign 0.01
R7679:Atm UTSW 9 53,353,797 (GRCm39) missense probably damaging 1.00
R7720:Atm UTSW 9 53,433,539 (GRCm39) missense possibly damaging 0.54
R8221:Atm UTSW 9 53,367,288 (GRCm39) splice site probably null
R8247:Atm UTSW 9 53,361,870 (GRCm39) missense
R8334:Atm UTSW 9 53,433,573 (GRCm39) missense probably benign 0.00
R8503:Atm UTSW 9 53,399,352 (GRCm39) missense probably damaging 0.99
R8552:Atm UTSW 9 53,435,797 (GRCm39) missense probably damaging 1.00
R8749:Atm UTSW 9 53,410,497 (GRCm39) nonsense probably null
R8838:Atm UTSW 9 53,427,851 (GRCm39) missense probably damaging 0.99
R9126:Atm UTSW 9 53,370,134 (GRCm39) missense probably benign 0.01
R9131:Atm UTSW 9 53,445,044 (GRCm39) missense probably benign 0.10
R9191:Atm UTSW 9 53,438,590 (GRCm39) missense probably benign 0.29
R9257:Atm UTSW 9 53,407,150 (GRCm39) critical splice donor site probably null
R9473:Atm UTSW 9 53,410,272 (GRCm39) missense probably benign
R9558:Atm UTSW 9 53,412,081 (GRCm39) missense probably benign 0.00
R9598:Atm UTSW 9 53,431,381 (GRCm39) missense probably benign 0.34
R9717:Atm UTSW 9 53,427,817 (GRCm39) missense probably damaging 1.00
R9794:Atm UTSW 9 53,429,867 (GRCm39) missense probably benign
X0067:Atm UTSW 9 53,390,994 (GRCm39) missense probably benign 0.00
Z1088:Atm UTSW 9 53,442,987 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAGTCTTTAGAGCTGCCAG -3'
(R):5'- AGCCATTTTGATGAGGTGAAGTC -3'

Sequencing Primer
(F):5'- TGCCAGCGCATATCCAGGATC -3'
(R):5'- GGTGAAGTCCATTGCTAATCAG -3'
Posted On 2017-12-01