Mutagenetix > Incidental Mutation

Incidental Mutation 'R6715:Atm'

529295

Institutional Source

Beutler Lab

Gene Symbol

Atm

Ensembl Gene

ENSMUSG00000034218

Gene Name

ataxia telangiectasia mutated

Synonyms

C030026E19Rik

MMRRC Submission

044833-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.905) question?

Stock #

R6715 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53350449-53448040 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 53442948 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 105 (I105T)

Ref Sequence

ENSEMBL: ENSMUSP00000156344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000150244] [ENSMUST00000232179]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000118282
AA Change: I105T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: I105T

Domain	Start	End	E-Value	Type
TAN	1	166	5.07e-68	SMART
low complexity region	431	445	N/A	INTRINSIC
low complexity region	830	846	N/A	INTRINSIC
low complexity region	929	940	N/A	INTRINSIC
SCOP:d1gw5a_	1039	1568	2e-4	SMART
coiled coil region	1615	1644	N/A	INTRINSIC
low complexity region	1650	1662	N/A	INTRINSIC
Pfam:FAT	2102	2499	4.4e-50	PFAM
low complexity region	2587	2599	N/A	INTRINSIC
PI3Kc	2723	3026	1.11e-117	SMART
FATC	3034	3066	3.71e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132403

Predicted Effect

probably damaging
Transcript: ENSMUST00000150244
AA Change: I87T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115394
Gene: ENSMUSG00000034218
AA Change: I87T

Domain	Start	End	E-Value	Type
TAN	1	140	2.88e-40	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000232179
AA Change: I105T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.7173

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.9%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adck1	G	A	12: 88,425,850 (GRCm39)	R426H	probably damaging	Het
Arl2	G	A	19: 6,187,555 (GRCm39)	R98C	probably damaging	Het
Cnnm2	G	A	19: 46,842,412 (GRCm39)	G565E	probably damaging	Het
Ddx60	G	A	8: 62,436,924 (GRCm39)	G958D	probably benign	Het
Fbxo2	T	A	4: 148,250,226 (GRCm39)	M252K	probably benign	Het
Filip1	C	A	9: 79,726,040 (GRCm39)	A860S	probably benign	Het
Gm11992	C	A	11: 9,011,214 (GRCm39)	S218R	probably damaging	Het
Gnb3	A	G	6: 124,814,691 (GRCm39)	L69P	possibly damaging	Het
Gpr18	T	G	14: 122,149,389 (GRCm39)	H212P	possibly damaging	Het
Iqcb1	T	C	16: 36,655,991 (GRCm39)	F126S	probably damaging	Het
Katnip	C	T	7: 125,361,001 (GRCm39)	Q104*	probably null	Het
Kcnh1	A	G	1: 192,019,949 (GRCm39)	D425G	probably benign	Het
Kdm5b	T	A	1: 134,536,799 (GRCm39)		probably null	Het
Mcm3ap	C	T	10: 76,325,366 (GRCm39)	T989M	possibly damaging	Het
Mtor	T	C	4: 148,623,004 (GRCm39)	C1999R	probably benign	Het
Myo1c	C	T	11: 75,562,461 (GRCm39)	P918S	probably benign	Het
Myof	A	T	19: 37,956,794 (GRCm39)	D508E	probably benign	Het
Or52b2	A	T	7: 104,986,539 (GRCm39)	I128N	probably damaging	Het
Or56b2j	G	A	7: 104,353,163 (GRCm39)	V130M	possibly damaging	Het
Or5l13	T	A	2: 87,780,335 (GRCm39)	M81L	probably benign	Het
Osbpl7	A	G	11: 96,945,425 (GRCm39)	H266R	probably damaging	Het
Pear1	T	C	3: 87,666,424 (GRCm39)	Y93C	probably damaging	Het
Pgr	A	G	9: 8,965,000 (GRCm39)	H881R	possibly damaging	Het
Rfx1	A	G	8: 84,822,444 (GRCm39)	E914G	possibly damaging	Het
Samm50	T	C	15: 84,095,259 (GRCm39)	I415T	probably benign	Het
Snx7	T	C	3: 117,575,985 (GRCm39)	D434G	possibly damaging	Het
Susd4	G	A	1: 182,719,602 (GRCm39)	V406M	probably benign	Het
Syt15	G	T	14: 33,944,819 (GRCm39)	G122V	probably damaging	Het
Tlr5	A	G	1: 182,800,224 (GRCm39)		probably benign	Het
Ttc6	T	C	12: 57,721,556 (GRCm39)		probably null	Het
Vmn1r211	C	A	13: 23,035,949 (GRCm39)	M239I	probably benign	Het
Vps37a	G	T	8: 40,993,902 (GRCm39)		probably null	Het

Other mutations in Atm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Atm	APN	9	53,435,743 (GRCm39)	missense	probably damaging	1.00
IGL00466:Atm	APN	9	53,410,412 (GRCm39)	splice site	probably benign
IGL00567:Atm	APN	9	53,414,416 (GRCm39)	nonsense	probably null
IGL00702:Atm	APN	9	53,423,131 (GRCm39)	missense	probably benign	0.02
IGL00743:Atm	APN	9	53,424,416 (GRCm39)	missense	probably benign	0.00
IGL00771:Atm	APN	9	53,404,354 (GRCm39)	missense	probably benign	0.01
IGL00773:Atm	APN	9	53,433,444 (GRCm39)	missense	probably benign	0.00
IGL00819:Atm	APN	9	53,429,831 (GRCm39)	missense	probably damaging	1.00
IGL00864:Atm	APN	9	53,445,233 (GRCm39)	missense	probably damaging	0.99
IGL00985:Atm	APN	9	53,371,116 (GRCm39)	missense	probably damaging	0.98
IGL01109:Atm	APN	9	53,401,593 (GRCm39)	missense	probably damaging	1.00
IGL01120:Atm	APN	9	53,372,422 (GRCm39)	critical splice acceptor site	probably null
IGL01369:Atm	APN	9	53,426,617 (GRCm39)	missense	probably benign
IGL01374:Atm	APN	9	53,443,024 (GRCm39)	missense	possibly damaging	0.58
IGL01406:Atm	APN	9	53,351,046 (GRCm39)	makesense	probably null
IGL01409:Atm	APN	9	53,410,471 (GRCm39)	missense	probably benign	0.01
IGL01434:Atm	APN	9	53,419,107 (GRCm39)	missense	probably benign	0.04
IGL01486:Atm	APN	9	53,421,513 (GRCm39)	missense	probably benign
IGL01583:Atm	APN	9	53,395,547 (GRCm39)	splice site	probably benign
IGL01861:Atm	APN	9	53,405,912 (GRCm39)	missense	probably null	0.89
IGL01865:Atm	APN	9	53,372,302 (GRCm39)	missense	probably damaging	1.00
IGL02026:Atm	APN	9	53,353,717 (GRCm39)	splice site	probably null
IGL02072:Atm	APN	9	53,371,096 (GRCm39)	missense	probably benign	0.01
IGL02075:Atm	APN	9	53,438,537 (GRCm39)	missense	probably damaging	1.00
IGL02127:Atm	APN	9	53,399,283 (GRCm39)	missense	probably damaging	1.00
IGL02175:Atm	APN	9	53,391,965 (GRCm39)	missense	probably damaging	0.99
IGL02246:Atm	APN	9	53,438,485 (GRCm39)	missense	probably benign	0.12
IGL02259:Atm	APN	9	53,429,794 (GRCm39)	splice site	probably benign
IGL02351:Atm	APN	9	53,433,476 (GRCm39)	missense	probably benign	0.04
IGL02358:Atm	APN	9	53,433,476 (GRCm39)	missense	probably benign	0.04
IGL02387:Atm	APN	9	53,391,066 (GRCm39)	splice site	probably null
IGL02417:Atm	APN	9	53,390,995 (GRCm39)	missense	probably benign	0.00
IGL02422:Atm	APN	9	53,412,092 (GRCm39)	missense	probably damaging	1.00
IGL02445:Atm	APN	9	53,365,630 (GRCm39)	missense	probably benign	0.00
IGL02492:Atm	APN	9	53,367,159 (GRCm39)	missense	probably damaging	0.99
IGL02513:Atm	APN	9	53,408,562 (GRCm39)	splice site	probably benign
IGL02633:Atm	APN	9	53,359,453 (GRCm39)	missense	probably damaging	1.00
IGL02634:Atm	APN	9	53,427,863 (GRCm39)	missense	probably benign	0.00
IGL02948:Atm	APN	9	53,364,740 (GRCm39)	splice site	probably benign
IGL02959:Atm	APN	9	53,382,718 (GRCm39)	missense	probably damaging	1.00
IGL02965:Atm	APN	9	53,364,863 (GRCm39)	missense	probably damaging	1.00
IGL03085:Atm	APN	9	53,395,471 (GRCm39)	missense	possibly damaging	0.89
antebellum	UTSW	9	53,429,859 (GRCm39)	nonsense	probably null
bull_run	UTSW	9	53,399,222 (GRCm39)	missense	probably benign	0.09
Civil	UTSW	9	53,403,568 (GRCm39)	missense	possibly damaging	0.78
gettysburg	UTSW	9	53,367,288 (GRCm39)	splice site	probably null
Grant	UTSW	9	53,423,217 (GRCm39)	nonsense	probably null
Indicative	UTSW	9	53,356,676 (GRCm39)	splice site	probably null
Marker	UTSW	9	53,365,579 (GRCm39)	splice site	probably benign
maunder	UTSW	9	53,410,497 (GRCm39)	nonsense	probably null
mockingbird	UTSW	9	53,427,767 (GRCm39)	nonsense	probably null
mockingbird2	UTSW	9	53,399,887 (GRCm39)	missense	probably damaging	1.00
osphere	UTSW	9	53,390,973 (GRCm39)	missense	probably damaging	0.99
shiloh	UTSW	9	53,376,598 (GRCm39)	missense	probably damaging	1.00
Strato	UTSW	9	53,414,318 (GRCm39)	missense	probably damaging	1.00
thrasher	UTSW	9	53,356,807 (GRCm39)	missense	probably benign	0.01
Tropo	UTSW	9	53,442,948 (GRCm39)	missense	probably damaging	1.00
P0019:Atm	UTSW	9	53,376,328 (GRCm39)	splice site	probably benign
PIT4403001:Atm	UTSW	9	53,412,282 (GRCm39)	missense	probably benign
PIT4687001:Atm	UTSW	9	53,398,112 (GRCm39)	critical splice donor site	probably null
R0004:Atm	UTSW	9	53,364,828 (GRCm39)	splice site	probably benign
R0035:Atm	UTSW	9	53,424,480 (GRCm39)	missense	probably benign	0.01
R0098:Atm	UTSW	9	53,429,869 (GRCm39)	missense	probably benign	0.10
R0098:Atm	UTSW	9	53,429,869 (GRCm39)	missense	probably benign	0.10
R0201:Atm	UTSW	9	53,365,579 (GRCm39)	splice site	probably benign
R0304:Atm	UTSW	9	53,427,644 (GRCm39)	missense	probably benign	0.34
R0308:Atm	UTSW	9	53,365,773 (GRCm39)	splice site	probably null
R0362:Atm	UTSW	9	53,370,138 (GRCm39)	missense	possibly damaging	0.90
R0470:Atm	UTSW	9	53,372,266 (GRCm39)	missense	probably damaging	1.00
R0513:Atm	UTSW	9	53,415,248 (GRCm39)	missense	probably benign	0.00
R0589:Atm	UTSW	9	53,401,492 (GRCm39)	missense	possibly damaging	0.51
R0617:Atm	UTSW	9	53,370,241 (GRCm39)	nonsense	probably null
R0630:Atm	UTSW	9	53,442,922 (GRCm39)	splice site	probably benign
R0652:Atm	UTSW	9	53,397,314 (GRCm39)	missense	probably damaging	0.98
R0698:Atm	UTSW	9	53,426,539 (GRCm39)	missense	probably damaging	1.00
R0737:Atm	UTSW	9	53,367,866 (GRCm39)	missense	probably damaging	1.00
R0885:Atm	UTSW	9	53,371,123 (GRCm39)	missense	probably benign
R0947:Atm	UTSW	9	53,415,392 (GRCm39)	missense	probably benign	0.01
R0948:Atm	UTSW	9	53,407,258 (GRCm39)	missense	probably benign
R1144:Atm	UTSW	9	53,422,998 (GRCm39)	splice site	probably benign
R1252:Atm	UTSW	9	53,367,140 (GRCm39)	missense	probably damaging	1.00
R1295:Atm	UTSW	9	53,367,830 (GRCm39)	missense	probably damaging	1.00
R1296:Atm	UTSW	9	53,367,830 (GRCm39)	missense	probably damaging	1.00
R1419:Atm	UTSW	9	53,368,789 (GRCm39)	missense	probably benign	0.00
R1477:Atm	UTSW	9	53,375,573 (GRCm39)	missense	probably benign	0.00
R1596:Atm	UTSW	9	53,364,678 (GRCm39)	missense	probably damaging	1.00
R1630:Atm	UTSW	9	53,390,973 (GRCm39)	missense	probably damaging	0.99
R1667:Atm	UTSW	9	53,412,232 (GRCm39)	missense	probably damaging	1.00
R1681:Atm	UTSW	9	53,433,455 (GRCm39)	missense	possibly damaging	0.94
R1703:Atm	UTSW	9	53,412,000 (GRCm39)	missense	probably benign
R1817:Atm	UTSW	9	53,403,533 (GRCm39)	splice site	probably benign
R1840:Atm	UTSW	9	53,367,830 (GRCm39)	missense	probably damaging	1.00
R1848:Atm	UTSW	9	53,379,312 (GRCm39)	missense	probably benign	0.06
R1906:Atm	UTSW	9	53,417,868 (GRCm39)	missense	probably damaging	1.00
R1958:Atm	UTSW	9	53,382,718 (GRCm39)	missense	probably damaging	1.00
R2108:Atm	UTSW	9	53,355,297 (GRCm39)	missense	probably damaging	1.00
R2116:Atm	UTSW	9	53,412,269 (GRCm39)	missense	probably benign	0.36
R2134:Atm	UTSW	9	53,379,264 (GRCm39)	critical splice donor site	probably null
R2137:Atm	UTSW	9	53,364,675 (GRCm39)	missense	probably damaging	1.00
R2291:Atm	UTSW	9	53,402,209 (GRCm39)	splice site	probably null
R2348:Atm	UTSW	9	53,403,568 (GRCm39)	missense	possibly damaging	0.78
R2483:Atm	UTSW	9	53,421,566 (GRCm39)	missense	probably damaging	1.00
R2567:Atm	UTSW	9	53,368,770 (GRCm39)	missense	possibly damaging	0.72
R2897:Atm	UTSW	9	53,419,105 (GRCm39)	missense	probably damaging	0.99
R2939:Atm	UTSW	9	53,406,011 (GRCm39)	missense	probably damaging	1.00
R3008:Atm	UTSW	9	53,392,050 (GRCm39)	missense	probably benign	0.00
R3236:Atm	UTSW	9	53,391,048 (GRCm39)	missense	probably benign	0.15
R3847:Atm	UTSW	9	53,414,375 (GRCm39)	missense	possibly damaging	0.94
R3889:Atm	UTSW	9	53,417,936 (GRCm39)	splice site	probably benign
R3919:Atm	UTSW	9	53,403,578 (GRCm39)	missense	probably benign	0.00
R4125:Atm	UTSW	9	53,361,921 (GRCm39)	missense	probably damaging	1.00
R4222:Atm	UTSW	9	53,391,969 (GRCm39)	missense	probably benign
R4395:Atm	UTSW	9	53,376,527 (GRCm39)	missense	probably benign	0.09
R4466:Atm	UTSW	9	53,359,469 (GRCm39)	nonsense	probably null
R4502:Atm	UTSW	9	53,407,246 (GRCm39)	missense	possibly damaging	0.92
R4514:Atm	UTSW	9	53,404,339 (GRCm39)	missense	probably damaging	0.99
R4528:Atm	UTSW	9	53,412,059 (GRCm39)	missense	probably benign	0.39
R4593:Atm	UTSW	9	53,364,894 (GRCm39)	missense	possibly damaging	0.55
R4627:Atm	UTSW	9	53,367,806 (GRCm39)	missense	possibly damaging	0.79
R4634:Atm	UTSW	9	53,443,033 (GRCm39)	missense	probably benign	0.01
R4665:Atm	UTSW	9	53,375,529 (GRCm39)	missense	probably benign	0.00
R4672:Atm	UTSW	9	53,433,501 (GRCm39)	missense	probably damaging	0.99
R4741:Atm	UTSW	9	53,364,907 (GRCm39)	missense	probably benign	0.10
R4808:Atm	UTSW	9	53,356,795 (GRCm39)	missense	probably damaging	0.99
R4959:Atm	UTSW	9	53,426,601 (GRCm39)	missense	probably benign
R4996:Atm	UTSW	9	53,435,807 (GRCm39)	missense	probably benign	0.09
R5030:Atm	UTSW	9	53,431,409 (GRCm39)	nonsense	probably null
R5214:Atm	UTSW	9	53,402,327 (GRCm39)	missense	probably benign	0.09
R5260:Atm	UTSW	9	53,417,911 (GRCm39)	missense	probably damaging	0.99
R5311:Atm	UTSW	9	53,429,923 (GRCm39)	missense	probably benign	0.00
R5394:Atm	UTSW	9	53,419,077 (GRCm39)	critical splice donor site	probably null
R5400:Atm	UTSW	9	53,414,318 (GRCm39)	missense	probably damaging	1.00
R5436:Atm	UTSW	9	53,371,104 (GRCm39)	missense	probably benign	0.00
R5441:Atm	UTSW	9	53,427,767 (GRCm39)	nonsense	probably null
R5569:Atm	UTSW	9	53,427,750 (GRCm39)	nonsense	probably null
R5856:Atm	UTSW	9	53,407,255 (GRCm39)	missense	possibly damaging	0.64
R5891:Atm	UTSW	9	53,408,459 (GRCm39)	missense	probably benign
R5910:Atm	UTSW	9	53,359,380 (GRCm39)	missense	probably damaging	0.96
R6054:Atm	UTSW	9	53,371,173 (GRCm39)	missense	probably damaging	1.00
R6062:Atm	UTSW	9	53,399,887 (GRCm39)	missense	probably damaging	1.00
R6092:Atm	UTSW	9	53,435,714 (GRCm39)	missense	probably damaging	1.00
R6127:Atm	UTSW	9	53,435,809 (GRCm39)	missense	probably damaging	1.00
R6160:Atm	UTSW	9	53,402,259 (GRCm39)	missense	probably benign	0.04
R6267:Atm	UTSW	9	53,355,300 (GRCm39)	missense	probably damaging	1.00
R6273:Atm	UTSW	9	53,399,222 (GRCm39)	missense	probably benign	0.09
R6284:Atm	UTSW	9	53,356,676 (GRCm39)	splice site	probably null
R6478:Atm	UTSW	9	53,401,554 (GRCm39)	missense	probably damaging	1.00
R6547:Atm	UTSW	9	53,351,457 (GRCm39)	missense	probably damaging	1.00
R6549:Atm	UTSW	9	53,404,477 (GRCm39)	missense	probably benign	0.00
R6704:Atm	UTSW	9	53,370,153 (GRCm39)	missense	probably benign	0.02
R6737:Atm	UTSW	9	53,397,351 (GRCm39)	missense	probably benign	0.30
R6759:Atm	UTSW	9	53,429,859 (GRCm39)	nonsense	probably null
R6766:Atm	UTSW	9	53,401,582 (GRCm39)	missense	probably damaging	0.99
R6813:Atm	UTSW	9	53,408,535 (GRCm39)	missense	probably benign	0.00
R6852:Atm	UTSW	9	53,393,730 (GRCm39)	missense	possibly damaging	0.93
R7064:Atm	UTSW	9	53,419,181 (GRCm39)	missense	probably benign	0.02
R7208:Atm	UTSW	9	53,423,308 (GRCm39)	splice site	probably null
R7211:Atm	UTSW	9	53,399,860 (GRCm39)	missense	probably benign	0.01
R7220:Atm	UTSW	9	53,423,217 (GRCm39)	nonsense	probably null
R7336:Atm	UTSW	9	53,373,803 (GRCm39)	missense	possibly damaging	0.47
R7363:Atm	UTSW	9	53,376,598 (GRCm39)	missense	probably damaging	1.00
R7378:Atm	UTSW	9	53,364,737 (GRCm39)	critical splice acceptor site	probably null
R7472:Atm	UTSW	9	53,359,425 (GRCm39)	missense	possibly damaging	0.81
R7487:Atm	UTSW	9	53,435,654 (GRCm39)	missense	probably benign
R7497:Atm	UTSW	9	53,423,191 (GRCm39)	missense	probably benign	0.00
R7584:Atm	UTSW	9	53,424,427 (GRCm39)	missense	probably damaging	0.99
R7624:Atm	UTSW	9	53,366,068 (GRCm39)	missense	probably damaging	0.99
R7653:Atm	UTSW	9	53,401,602 (GRCm39)	nonsense	probably null
R7660:Atm	UTSW	9	53,356,807 (GRCm39)	missense	probably benign	0.01
R7679:Atm	UTSW	9	53,353,797 (GRCm39)	missense	probably damaging	1.00
R7720:Atm	UTSW	9	53,433,539 (GRCm39)	missense	possibly damaging	0.54
R8221:Atm	UTSW	9	53,367,288 (GRCm39)	splice site	probably null
R8247:Atm	UTSW	9	53,361,870 (GRCm39)	missense
R8334:Atm	UTSW	9	53,433,573 (GRCm39)	missense	probably benign	0.00
R8503:Atm	UTSW	9	53,399,352 (GRCm39)	missense	probably damaging	0.99
R8552:Atm	UTSW	9	53,435,797 (GRCm39)	missense	probably damaging	1.00
R8749:Atm	UTSW	9	53,410,497 (GRCm39)	nonsense	probably null
R8838:Atm	UTSW	9	53,427,851 (GRCm39)	missense	probably damaging	0.99
R9126:Atm	UTSW	9	53,370,134 (GRCm39)	missense	probably benign	0.01
R9131:Atm	UTSW	9	53,445,044 (GRCm39)	missense	probably benign	0.10
R9191:Atm	UTSW	9	53,438,590 (GRCm39)	missense	probably benign	0.29
R9257:Atm	UTSW	9	53,407,150 (GRCm39)	critical splice donor site	probably null
R9473:Atm	UTSW	9	53,410,272 (GRCm39)	missense	probably benign
R9558:Atm	UTSW	9	53,412,081 (GRCm39)	missense	probably benign	0.00
R9598:Atm	UTSW	9	53,431,381 (GRCm39)	missense	probably benign	0.34
R9717:Atm	UTSW	9	53,427,817 (GRCm39)	missense	probably damaging	1.00
R9794:Atm	UTSW	9	53,429,867 (GRCm39)	missense	probably benign
X0067:Atm	UTSW	9	53,390,994 (GRCm39)	missense	probably benign	0.00
Z1088:Atm	UTSW	9	53,442,987 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTACGCTAACTCCTGAAGC -3'
(R):5'- ACAAGAGATTGTTTCATGTGTCTGG -3'

Sequencing Primer
(F):5'- ACGCTAACTCCTGAAGCATTTGTG -3'
(R):5'- TGGTACAACAGTGTGGTTTAAAAG -3'

Posted On

2018-07-24