Incidental Mutation 'R6759:Atm'
ID 531147
Institutional Source Beutler Lab
Gene Symbol Atm
Ensembl Gene ENSMUSG00000034218
Gene Name ataxia telangiectasia mutated
Synonyms C030026E19Rik
MMRRC Submission 044875-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.905) question?
Stock # R6759 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 53350449-53448040 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 53429859 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 392 (W392*)
Ref Sequence ENSEMBL: ENSMUSP00000156344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000118282
AA Change: W392*
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: W392*

DomainStartEndE-ValueType
TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132403
Predicted Effect probably null
Transcript: ENSMUST00000232179
AA Change: W392*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,331,692 (GRCm39) S841G probably benign Het
4933427I04Rik G T 4: 123,753,879 (GRCm39) probably benign Het
Aak1 A G 6: 86,921,399 (GRCm39) T199A probably damaging Het
Acnat2 C A 4: 49,380,254 (GRCm39) V375L probably benign Het
Aldh1a7 T C 19: 20,677,320 (GRCm39) T434A possibly damaging Het
Aldh3a2 T C 11: 61,156,088 (GRCm39) T63A probably benign Het
Anxa2 T C 9: 69,391,103 (GRCm39) S97P probably damaging Het
Apip T C 2: 102,922,191 (GRCm39) S186P probably benign Het
Apob A G 12: 8,061,049 (GRCm39) K3177R probably benign Het
Atp8b1 T A 18: 64,679,161 (GRCm39) R773S probably benign Het
Bicdl2 T A 17: 23,885,718 (GRCm39) probably null Het
Bltp1 C T 3: 37,042,234 (GRCm39) T2740I possibly damaging Het
Cacng3 G A 7: 122,361,547 (GRCm39) probably null Het
Clca3a1 G T 3: 144,455,450 (GRCm39) L448M probably damaging Het
Clk4 A G 11: 51,166,401 (GRCm39) I94M possibly damaging Het
Cnot3 G T 7: 3,654,918 (GRCm39) V124F probably damaging Het
Cyp4a30b C T 4: 115,318,571 (GRCm39) A426V probably benign Het
Dact1 T A 12: 71,364,911 (GRCm39) L564* probably null Het
Dnah8 T A 17: 30,882,266 (GRCm39) probably null Het
Dock5 T A 14: 68,033,445 (GRCm39) T975S probably benign Het
Dock8 C A 19: 25,104,848 (GRCm39) H739Q probably damaging Het
Efr3b T A 12: 4,034,613 (GRCm39) N186Y probably damaging Het
Enam G A 5: 88,649,550 (GRCm39) G278D probably damaging Het
Fgl2 A G 5: 21,578,256 (GRCm39) D181G probably benign Het
Gfra3 G T 18: 34,828,926 (GRCm39) S156* probably null Het
Jam3 G C 9: 27,013,276 (GRCm39) T98S probably benign Het
Ltbp2 A T 12: 84,834,184 (GRCm39) I1435N probably damaging Het
Man2a1 G A 17: 64,932,383 (GRCm39) A157T probably benign Het
Mcm3ap T A 10: 76,337,148 (GRCm39) V1361E probably benign Het
Nobox A T 6: 43,284,538 (GRCm39) L36Q possibly damaging Het
Or2ag12 T A 7: 106,277,100 (GRCm39) M198L probably benign Het
Or51a10 A G 7: 103,699,334 (GRCm39) S76P probably damaging Het
Parp4 G A 14: 56,857,947 (GRCm39) V860I probably benign Het
Pim3 T A 15: 88,747,296 (GRCm39) probably null Het
Ptpn13 A T 5: 103,713,121 (GRCm39) N1748I possibly damaging Het
Rad51ap2 A G 12: 11,507,145 (GRCm39) T356A possibly damaging Het
Ranbp2 C T 10: 58,293,559 (GRCm39) R310* probably null Het
Rassf5 C T 1: 131,109,988 (GRCm39) V190I probably benign Het
Rgl1 T G 1: 152,409,281 (GRCm39) Q481P probably damaging Het
Rrp1b A G 17: 32,276,063 (GRCm39) T537A probably benign Het
Smok3c T A 5: 138,063,699 (GRCm39) S395R probably benign Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Strn4 A T 7: 16,556,978 (GRCm39) E145V probably damaging Het
Tex21 T A 12: 76,251,086 (GRCm39) probably null Het
Usp37 G A 1: 74,534,908 (GRCm39) R13* probably null Het
Uty G T Y: 1,174,735 (GRCm39) L222I probably damaging Homo
Wwp2 A G 8: 108,267,314 (GRCm39) T309A probably damaging Het
Zfp40 C T 17: 23,395,510 (GRCm39) R359H possibly damaging Het
Other mutations in Atm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53,435,743 (GRCm39) missense probably damaging 1.00
IGL00466:Atm APN 9 53,410,412 (GRCm39) splice site probably benign
IGL00567:Atm APN 9 53,414,416 (GRCm39) nonsense probably null
IGL00702:Atm APN 9 53,423,131 (GRCm39) missense probably benign 0.02
IGL00743:Atm APN 9 53,424,416 (GRCm39) missense probably benign 0.00
IGL00771:Atm APN 9 53,404,354 (GRCm39) missense probably benign 0.01
IGL00773:Atm APN 9 53,433,444 (GRCm39) missense probably benign 0.00
IGL00819:Atm APN 9 53,429,831 (GRCm39) missense probably damaging 1.00
IGL00864:Atm APN 9 53,445,233 (GRCm39) missense probably damaging 0.99
IGL00985:Atm APN 9 53,371,116 (GRCm39) missense probably damaging 0.98
IGL01109:Atm APN 9 53,401,593 (GRCm39) missense probably damaging 1.00
IGL01120:Atm APN 9 53,372,422 (GRCm39) critical splice acceptor site probably null
IGL01369:Atm APN 9 53,426,617 (GRCm39) missense probably benign
IGL01374:Atm APN 9 53,443,024 (GRCm39) missense possibly damaging 0.58
IGL01406:Atm APN 9 53,351,046 (GRCm39) makesense probably null
IGL01409:Atm APN 9 53,410,471 (GRCm39) missense probably benign 0.01
IGL01434:Atm APN 9 53,419,107 (GRCm39) missense probably benign 0.04
IGL01486:Atm APN 9 53,421,513 (GRCm39) missense probably benign
IGL01583:Atm APN 9 53,395,547 (GRCm39) splice site probably benign
IGL01861:Atm APN 9 53,405,912 (GRCm39) missense probably null 0.89
IGL01865:Atm APN 9 53,372,302 (GRCm39) missense probably damaging 1.00
IGL02026:Atm APN 9 53,353,717 (GRCm39) splice site probably null
IGL02072:Atm APN 9 53,371,096 (GRCm39) missense probably benign 0.01
IGL02075:Atm APN 9 53,438,537 (GRCm39) missense probably damaging 1.00
IGL02127:Atm APN 9 53,399,283 (GRCm39) missense probably damaging 1.00
IGL02175:Atm APN 9 53,391,965 (GRCm39) missense probably damaging 0.99
IGL02246:Atm APN 9 53,438,485 (GRCm39) missense probably benign 0.12
IGL02259:Atm APN 9 53,429,794 (GRCm39) splice site probably benign
IGL02351:Atm APN 9 53,433,476 (GRCm39) missense probably benign 0.04
IGL02358:Atm APN 9 53,433,476 (GRCm39) missense probably benign 0.04
IGL02387:Atm APN 9 53,391,066 (GRCm39) splice site probably null
IGL02417:Atm APN 9 53,390,995 (GRCm39) missense probably benign 0.00
IGL02422:Atm APN 9 53,412,092 (GRCm39) missense probably damaging 1.00
IGL02445:Atm APN 9 53,365,630 (GRCm39) missense probably benign 0.00
IGL02492:Atm APN 9 53,367,159 (GRCm39) missense probably damaging 0.99
IGL02513:Atm APN 9 53,408,562 (GRCm39) splice site probably benign
IGL02633:Atm APN 9 53,359,453 (GRCm39) missense probably damaging 1.00
IGL02634:Atm APN 9 53,427,863 (GRCm39) missense probably benign 0.00
IGL02948:Atm APN 9 53,364,740 (GRCm39) splice site probably benign
IGL02959:Atm APN 9 53,382,718 (GRCm39) missense probably damaging 1.00
IGL02965:Atm APN 9 53,364,863 (GRCm39) missense probably damaging 1.00
IGL03085:Atm APN 9 53,395,471 (GRCm39) missense possibly damaging 0.89
antebellum UTSW 9 53,429,859 (GRCm39) nonsense probably null
bull_run UTSW 9 53,399,222 (GRCm39) missense probably benign 0.09
Civil UTSW 9 53,403,568 (GRCm39) missense possibly damaging 0.78
gettysburg UTSW 9 53,367,288 (GRCm39) splice site probably null
Grant UTSW 9 53,423,217 (GRCm39) nonsense probably null
Indicative UTSW 9 53,356,676 (GRCm39) splice site probably null
Marker UTSW 9 53,365,579 (GRCm39) splice site probably benign
maunder UTSW 9 53,410,497 (GRCm39) nonsense probably null
mockingbird UTSW 9 53,427,767 (GRCm39) nonsense probably null
mockingbird2 UTSW 9 53,399,887 (GRCm39) missense probably damaging 1.00
osphere UTSW 9 53,390,973 (GRCm39) missense probably damaging 0.99
shiloh UTSW 9 53,376,598 (GRCm39) missense probably damaging 1.00
Strato UTSW 9 53,414,318 (GRCm39) missense probably damaging 1.00
thrasher UTSW 9 53,356,807 (GRCm39) missense probably benign 0.01
Tropo UTSW 9 53,442,948 (GRCm39) missense probably damaging 1.00
P0019:Atm UTSW 9 53,376,328 (GRCm39) splice site probably benign
PIT4403001:Atm UTSW 9 53,412,282 (GRCm39) missense probably benign
PIT4687001:Atm UTSW 9 53,398,112 (GRCm39) critical splice donor site probably null
R0004:Atm UTSW 9 53,364,828 (GRCm39) splice site probably benign
R0035:Atm UTSW 9 53,424,480 (GRCm39) missense probably benign 0.01
R0098:Atm UTSW 9 53,429,869 (GRCm39) missense probably benign 0.10
R0098:Atm UTSW 9 53,429,869 (GRCm39) missense probably benign 0.10
R0201:Atm UTSW 9 53,365,579 (GRCm39) splice site probably benign
R0304:Atm UTSW 9 53,427,644 (GRCm39) missense probably benign 0.34
R0308:Atm UTSW 9 53,365,773 (GRCm39) splice site probably null
R0362:Atm UTSW 9 53,370,138 (GRCm39) missense possibly damaging 0.90
R0470:Atm UTSW 9 53,372,266 (GRCm39) missense probably damaging 1.00
R0513:Atm UTSW 9 53,415,248 (GRCm39) missense probably benign 0.00
R0589:Atm UTSW 9 53,401,492 (GRCm39) missense possibly damaging 0.51
R0617:Atm UTSW 9 53,370,241 (GRCm39) nonsense probably null
R0630:Atm UTSW 9 53,442,922 (GRCm39) splice site probably benign
R0652:Atm UTSW 9 53,397,314 (GRCm39) missense probably damaging 0.98
R0698:Atm UTSW 9 53,426,539 (GRCm39) missense probably damaging 1.00
R0737:Atm UTSW 9 53,367,866 (GRCm39) missense probably damaging 1.00
R0885:Atm UTSW 9 53,371,123 (GRCm39) missense probably benign
R0947:Atm UTSW 9 53,415,392 (GRCm39) missense probably benign 0.01
R0948:Atm UTSW 9 53,407,258 (GRCm39) missense probably benign
R1144:Atm UTSW 9 53,422,998 (GRCm39) splice site probably benign
R1252:Atm UTSW 9 53,367,140 (GRCm39) missense probably damaging 1.00
R1295:Atm UTSW 9 53,367,830 (GRCm39) missense probably damaging 1.00
R1296:Atm UTSW 9 53,367,830 (GRCm39) missense probably damaging 1.00
R1419:Atm UTSW 9 53,368,789 (GRCm39) missense probably benign 0.00
R1477:Atm UTSW 9 53,375,573 (GRCm39) missense probably benign 0.00
R1596:Atm UTSW 9 53,364,678 (GRCm39) missense probably damaging 1.00
R1630:Atm UTSW 9 53,390,973 (GRCm39) missense probably damaging 0.99
R1667:Atm UTSW 9 53,412,232 (GRCm39) missense probably damaging 1.00
R1681:Atm UTSW 9 53,433,455 (GRCm39) missense possibly damaging 0.94
R1703:Atm UTSW 9 53,412,000 (GRCm39) missense probably benign
R1817:Atm UTSW 9 53,403,533 (GRCm39) splice site probably benign
R1840:Atm UTSW 9 53,367,830 (GRCm39) missense probably damaging 1.00
R1848:Atm UTSW 9 53,379,312 (GRCm39) missense probably benign 0.06
R1906:Atm UTSW 9 53,417,868 (GRCm39) missense probably damaging 1.00
R1958:Atm UTSW 9 53,382,718 (GRCm39) missense probably damaging 1.00
R2108:Atm UTSW 9 53,355,297 (GRCm39) missense probably damaging 1.00
R2116:Atm UTSW 9 53,412,269 (GRCm39) missense probably benign 0.36
R2134:Atm UTSW 9 53,379,264 (GRCm39) critical splice donor site probably null
R2137:Atm UTSW 9 53,364,675 (GRCm39) missense probably damaging 1.00
R2291:Atm UTSW 9 53,402,209 (GRCm39) splice site probably null
R2348:Atm UTSW 9 53,403,568 (GRCm39) missense possibly damaging 0.78
R2483:Atm UTSW 9 53,421,566 (GRCm39) missense probably damaging 1.00
R2567:Atm UTSW 9 53,368,770 (GRCm39) missense possibly damaging 0.72
R2897:Atm UTSW 9 53,419,105 (GRCm39) missense probably damaging 0.99
R2939:Atm UTSW 9 53,406,011 (GRCm39) missense probably damaging 1.00
R3008:Atm UTSW 9 53,392,050 (GRCm39) missense probably benign 0.00
R3236:Atm UTSW 9 53,391,048 (GRCm39) missense probably benign 0.15
R3847:Atm UTSW 9 53,414,375 (GRCm39) missense possibly damaging 0.94
R3889:Atm UTSW 9 53,417,936 (GRCm39) splice site probably benign
R3919:Atm UTSW 9 53,403,578 (GRCm39) missense probably benign 0.00
R4125:Atm UTSW 9 53,361,921 (GRCm39) missense probably damaging 1.00
R4222:Atm UTSW 9 53,391,969 (GRCm39) missense probably benign
R4395:Atm UTSW 9 53,376,527 (GRCm39) missense probably benign 0.09
R4466:Atm UTSW 9 53,359,469 (GRCm39) nonsense probably null
R4502:Atm UTSW 9 53,407,246 (GRCm39) missense possibly damaging 0.92
R4514:Atm UTSW 9 53,404,339 (GRCm39) missense probably damaging 0.99
R4528:Atm UTSW 9 53,412,059 (GRCm39) missense probably benign 0.39
R4593:Atm UTSW 9 53,364,894 (GRCm39) missense possibly damaging 0.55
R4627:Atm UTSW 9 53,367,806 (GRCm39) missense possibly damaging 0.79
R4634:Atm UTSW 9 53,443,033 (GRCm39) missense probably benign 0.01
R4665:Atm UTSW 9 53,375,529 (GRCm39) missense probably benign 0.00
R4672:Atm UTSW 9 53,433,501 (GRCm39) missense probably damaging 0.99
R4741:Atm UTSW 9 53,364,907 (GRCm39) missense probably benign 0.10
R4808:Atm UTSW 9 53,356,795 (GRCm39) missense probably damaging 0.99
R4959:Atm UTSW 9 53,426,601 (GRCm39) missense probably benign
R4996:Atm UTSW 9 53,435,807 (GRCm39) missense probably benign 0.09
R5030:Atm UTSW 9 53,431,409 (GRCm39) nonsense probably null
R5214:Atm UTSW 9 53,402,327 (GRCm39) missense probably benign 0.09
R5260:Atm UTSW 9 53,417,911 (GRCm39) missense probably damaging 0.99
R5311:Atm UTSW 9 53,429,923 (GRCm39) missense probably benign 0.00
R5394:Atm UTSW 9 53,419,077 (GRCm39) critical splice donor site probably null
R5400:Atm UTSW 9 53,414,318 (GRCm39) missense probably damaging 1.00
R5436:Atm UTSW 9 53,371,104 (GRCm39) missense probably benign 0.00
R5441:Atm UTSW 9 53,427,767 (GRCm39) nonsense probably null
R5569:Atm UTSW 9 53,427,750 (GRCm39) nonsense probably null
R5856:Atm UTSW 9 53,407,255 (GRCm39) missense possibly damaging 0.64
R5891:Atm UTSW 9 53,408,459 (GRCm39) missense probably benign
R5910:Atm UTSW 9 53,359,380 (GRCm39) missense probably damaging 0.96
R6054:Atm UTSW 9 53,371,173 (GRCm39) missense probably damaging 1.00
R6062:Atm UTSW 9 53,399,887 (GRCm39) missense probably damaging 1.00
R6092:Atm UTSW 9 53,435,714 (GRCm39) missense probably damaging 1.00
R6127:Atm UTSW 9 53,435,809 (GRCm39) missense probably damaging 1.00
R6160:Atm UTSW 9 53,402,259 (GRCm39) missense probably benign 0.04
R6267:Atm UTSW 9 53,355,300 (GRCm39) missense probably damaging 1.00
R6273:Atm UTSW 9 53,399,222 (GRCm39) missense probably benign 0.09
R6284:Atm UTSW 9 53,356,676 (GRCm39) splice site probably null
R6478:Atm UTSW 9 53,401,554 (GRCm39) missense probably damaging 1.00
R6547:Atm UTSW 9 53,351,457 (GRCm39) missense probably damaging 1.00
R6549:Atm UTSW 9 53,404,477 (GRCm39) missense probably benign 0.00
R6704:Atm UTSW 9 53,370,153 (GRCm39) missense probably benign 0.02
R6715:Atm UTSW 9 53,442,948 (GRCm39) missense probably damaging 1.00
R6737:Atm UTSW 9 53,397,351 (GRCm39) missense probably benign 0.30
R6766:Atm UTSW 9 53,401,582 (GRCm39) missense probably damaging 0.99
R6813:Atm UTSW 9 53,408,535 (GRCm39) missense probably benign 0.00
R6852:Atm UTSW 9 53,393,730 (GRCm39) missense possibly damaging 0.93
R7064:Atm UTSW 9 53,419,181 (GRCm39) missense probably benign 0.02
R7208:Atm UTSW 9 53,423,308 (GRCm39) splice site probably null
R7211:Atm UTSW 9 53,399,860 (GRCm39) missense probably benign 0.01
R7220:Atm UTSW 9 53,423,217 (GRCm39) nonsense probably null
R7336:Atm UTSW 9 53,373,803 (GRCm39) missense possibly damaging 0.47
R7363:Atm UTSW 9 53,376,598 (GRCm39) missense probably damaging 1.00
R7378:Atm UTSW 9 53,364,737 (GRCm39) critical splice acceptor site probably null
R7472:Atm UTSW 9 53,359,425 (GRCm39) missense possibly damaging 0.81
R7487:Atm UTSW 9 53,435,654 (GRCm39) missense probably benign
R7497:Atm UTSW 9 53,423,191 (GRCm39) missense probably benign 0.00
R7584:Atm UTSW 9 53,424,427 (GRCm39) missense probably damaging 0.99
R7624:Atm UTSW 9 53,366,068 (GRCm39) missense probably damaging 0.99
R7653:Atm UTSW 9 53,401,602 (GRCm39) nonsense probably null
R7660:Atm UTSW 9 53,356,807 (GRCm39) missense probably benign 0.01
R7679:Atm UTSW 9 53,353,797 (GRCm39) missense probably damaging 1.00
R7720:Atm UTSW 9 53,433,539 (GRCm39) missense possibly damaging 0.54
R8221:Atm UTSW 9 53,367,288 (GRCm39) splice site probably null
R8247:Atm UTSW 9 53,361,870 (GRCm39) missense
R8334:Atm UTSW 9 53,433,573 (GRCm39) missense probably benign 0.00
R8503:Atm UTSW 9 53,399,352 (GRCm39) missense probably damaging 0.99
R8552:Atm UTSW 9 53,435,797 (GRCm39) missense probably damaging 1.00
R8749:Atm UTSW 9 53,410,497 (GRCm39) nonsense probably null
R8838:Atm UTSW 9 53,427,851 (GRCm39) missense probably damaging 0.99
R9126:Atm UTSW 9 53,370,134 (GRCm39) missense probably benign 0.01
R9131:Atm UTSW 9 53,445,044 (GRCm39) missense probably benign 0.10
R9191:Atm UTSW 9 53,438,590 (GRCm39) missense probably benign 0.29
R9257:Atm UTSW 9 53,407,150 (GRCm39) critical splice donor site probably null
R9473:Atm UTSW 9 53,410,272 (GRCm39) missense probably benign
R9558:Atm UTSW 9 53,412,081 (GRCm39) missense probably benign 0.00
R9598:Atm UTSW 9 53,431,381 (GRCm39) missense probably benign 0.34
R9717:Atm UTSW 9 53,427,817 (GRCm39) missense probably damaging 1.00
R9794:Atm UTSW 9 53,429,867 (GRCm39) missense probably benign
X0067:Atm UTSW 9 53,390,994 (GRCm39) missense probably benign 0.00
Z1088:Atm UTSW 9 53,442,987 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGCAGATGAGCCTTTTAGGG -3'
(R):5'- AGTTTTGGTAAGTGTCCCCAG -3'

Sequencing Primer
(F):5'- GAGCCTTTTAGGGATTATCTACAGC -3'
(R):5'- TGGTAAGTGTCCCCAGAAAATAAATG -3'
Posted On 2018-08-01