Figure 1. Mockingbird2 mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Mockingbird2 mice exhibit decreased frequencies of peripheral naive CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Mockingbird2 mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 5. Mockingbird2 mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 6. Mockingbird2 mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 7. Mockingbird2 mice exhibit increased expression of CD44 on peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 8. Mockingbird2 mice exhibit increased expression of CD44 on peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The mockingbird2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R6062, some of which showed an increase in the B to T cell ratio (Figure 1), reduced frequencies of CD4⁺ T cells (Figure 2), naive CD4 T cells in CD4 T cells (Figure 3), and naive CD8 T cells in CD8 T cells (Figure 4) with concomitant increased frequencies of central memory CD8 T cells in CD8 T cells (Figure 5) and effector memory CD4 T cells in CD4 T cells (Figure 6), all in the peripheral blood. Expression of CD44 on peripheral T cells (Figure 7) and CD8 T cells (Figure 8) was increased.

Whole exome HiSeq sequencing of the G1 grandsire identified 58 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Atm:  a T to C transition at base pair 53,488,587 (v38) on chromosome 9, or base pair 48,230 in the GenBank genomic region NC_000075.  The strongest association was found with a recessive model of inheritance to the normalized central memory CD8 T cells in CD8 T cells frequency phenotype, wherein two variant homozygotes departed phenotypically from 18 homozygous reference mice and 16 heterozygous mice with a P value of 7.779 x 10^-24 (Figure 9).  

The mutation corresponds to residue 4,731 in the mRNA sequence NM_007499 within exon 29 of 64 total exons.

4715 GTTATCGTTGGCACACTTATTCCCCTTGTGGAT

1526 -V--I--V--G--T--L--I--P--L--V--D-

The mutated nucleotide is indicated in red. The mutation results in a leucine to proline substitution at amino acid 1,531 (L1531P) in the ATM protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

ATM (ataxia telangiectasia mutated) is a member of the PI3/PI4-kinase (PIKK) family. The PIKK family members DNA-PK_CS (DNA-dependent protein kinase; see clover), ATR (ATM and Rad3-related), and ATM are involved in DNA repair [(1); reviewed in (2)]. A 250-amino acid region at the C-terminus of ATM constitutes the catalytic PIKK domain. The PIKK domain is flanked by the FAT domain (named for its homology to FRAP, ATM and TRRAP) and a FATC domain (FAT at the extreme C-terminus). The FAT and FATC domains occur in combination in all PIKK family members, suggesting a possible role in maintaining a structural conformation essential for the activation of the catalytic site (3;4). The FAT domain mediates ATM dimerization and has three tetratriocpeptide repeat domains (TRDs). The N-terminal portion of the protein up to the FAT domain consists of HEAT (Huntingtin, Elongation factor 3, A subunit of protein phosphatase 2A and TOR1) repeats (5). HEAT repeats are helical structural repeats that mediate protein-protein interactions (6).

The mockingbird2 mutation results in a leucine to proline substitution at amino acid 1,531 (L1531P) in the ATM protein; amino acid 1,531 is within the HEAT repeat region.

For more information about Atm, please see the record for mockingbird.

ATM is a cell cycle checkpoint kinase that phosphorylates proteins in several cell processes, including DNA repair, apoptosis, cell cycle checkpoints, telomere dysfunction, translation initiation, gene regulation, mitosis, and hypoxia. In all, there are 900 putative ATM/ATR phosphorylation sites on over 700 proteins in the DNA damage response (DDR) pathway alone (7).

Mutations in human ATM are linked to ataxia-telangiectasia [OMIM: #208900; (8;9)] and susceptibility to breast cancer (OMIM: #114480) as well as somatic B-cell non-Hodgkin lymphoma, somatic mantle cell lymphoma, and somatic T-cell prolymphocytic leukemia. Ataxia-telangiectasia is characterized by progressive cerebellar ataxia due to premature degeneration of Purkinje and granule cells, telangiectasia (dilated blood vessels), growth retardation, gonadal atrophy, immune defects, and a predisposition to malignancy (lymphoma, leukemia, and breast cancer). Fibroblasts from ataxia-telangiectasia patients exhibit aberrant gross morphology and cytoskeletal organization, poor cell growth, defective cell-cycle checkpoints, telomere loss, and chromosome end-to-end associations.

Atm­-deficient (Atm^-/-) mice exhibited reduced body weights, increased incidence of T-cell-derived lymphoma, premature death (median survival is 113 days), reduced numbers of CD4+ and CD8+ T cells, reduced numbers of CD3/CD4 and CD3/CD8 T cells, reduced numbers of active T cells, reduced numbers of pre-B cells, reduced levels of IgG, male and female infertility, hypoactivity, impaired coordination, impaired glucose tolerance, and insulin resistance (10-18). B cells from the Atm^-/- mice exhibited reduced class switch recombination with increased genomic instability after tamoxifen treatment compared to cells from wild-type mice (19). Homozygous mice expressing a kinase dead mutant Atm allele exhibited embryonic lethality from embryonic day (E) 9.5 to E10.5 (19). Homozygous mice expressing a mutant Atm allele (a 9 base pair in-frame deletion in exon 54 resulting in deletion of Ser2556-Arg2557-Iso2558 in the protein) exhibited premature death by 40 weeks of age (50%), reduced body size, increased tumor incidence, increased numbers of double-negative and single-positive T cells, reduced thymocyte numbers, and male infertility (16).

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 494 nucleotides is amplified (chromosome 9, - strand):

1   accattgaga gataagctat gacacttttt ttgtcaaatc ctataagaat tagagacatt
61  gagtaaaaaa gaacttgaaa tttatttcag agtagtttgt taggccttgc tatcattcat
121 tcattcattc attcattcat ttttcctgtt aggtcttctc atttcacaga tgtgtcgttg
181 cgtagctttt ccctttgctg tgacctatta agtcgagttt gtcatacagc tgtaactcaa
241 tgtaaggatg ctctagaaag ccatcttcac gttatcgttg gcacacttat tccccttgtg
301 gattatcagg aagttcaaga acaggtaatt tcccagtgca tctacaacag agtatttgag
361 acgaaagata ctcttaggaa ctgaatgctt taagtttacc ttaatgaaaa tgctttttga
421 taaatggtgg agaagacatt tttagcaaat taatccttga aatcaattac taccccttgg
481 tggttttgat ctaa

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.