Phenotypic Mutation 'osphere' (pdf version)
Alleleosphere
Mutation Type missense
Chromosome9
Coordinate53,479,673 bp (GRCm38)
Base Change A ⇒ T (forward strand)
Gene Atm
Gene Name ataxia telangiectasia mutated
Synonym(s) C030026E19Rik
Chromosomal Location 53,439,149-53,536,740 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_007499; MGI:107202

Mapped Yes 
Amino Acid Change Leucine changed to Glutamine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000113388] [ENSMUSP00000156344]
SMART Domains Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218
AA Change: L1867Q

DomainStartEndE-ValueType
TAN 1 166 5.07e-68 SMART
low complexity region 431 445 N/A INTRINSIC
low complexity region 830 846 N/A INTRINSIC
low complexity region 929 940 N/A INTRINSIC
SCOP:d1gw5a_ 1039 1568 2e-4 SMART
coiled coil region 1615 1644 N/A INTRINSIC
low complexity region 1650 1662 N/A INTRINSIC
Pfam:FAT 2102 2499 4.4e-50 PFAM
low complexity region 2587 2599 N/A INTRINSIC
PI3Kc 2723 3026 1.11e-117 SMART
FATC 3034 3066 3.71e-11 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
(Using ENSMUST00000118282)
Predicted Effect probably damaging

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
(Using ENSMUST00000232179)
Meta Mutation Damage Score 0.082 question?
Is this an essential gene? Possibly essential (E-score: 0.721) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B:T cells - increased
FACS B1 cells - increased
NALP3 inflammasome signaling defect
NLRP3 inflammasome: low response
phagocytosis in PECs - decreased
Candidate Explorer Status CE: excellent candidate; human score: 2; ML prob: 0.618
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(38) : Chemically induced (ENU)(2) Gene trapped(19) Targeted(17)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Atm APN 9 53524443 missense probably damaging 1.00
IGL00466:Atm APN 9 53499112 splice site probably benign
IGL00567:Atm APN 9 53503116 nonsense probably null
IGL00702:Atm APN 9 53511831 missense probably benign 0.02
IGL00743:Atm APN 9 53513116 missense probably benign 0.00
IGL00771:Atm APN 9 53493054 missense probably benign 0.01
IGL00773:Atm APN 9 53522144 missense probably benign 0.00
IGL00819:Atm APN 9 53518531 missense probably damaging 1.00
IGL00864:Atm APN 9 53533933 missense probably damaging 0.99
IGL00985:Atm APN 9 53459816 missense probably damaging 0.98
IGL01109:Atm APN 9 53490293 missense probably damaging 1.00
IGL01120:Atm APN 9 53461122 critical splice acceptor site probably null
IGL01369:Atm APN 9 53515317 missense probably benign
IGL01374:Atm APN 9 53531724 missense possibly damaging 0.58
IGL01406:Atm APN 9 53439746 makesense probably null
IGL01409:Atm APN 9 53499171 missense probably benign 0.01
IGL01434:Atm APN 9 53507807 missense probably benign 0.04
IGL01486:Atm APN 9 53510213 missense probably benign
IGL01583:Atm APN 9 53484247 splice site probably benign
IGL01861:Atm APN 9 53494612 missense probably null 0.89
IGL01865:Atm APN 9 53461002 missense probably damaging 1.00
IGL02026:Atm APN 9 53442417 unclassified probably null
IGL02072:Atm APN 9 53459796 missense probably benign 0.01
IGL02075:Atm APN 9 53527237 missense probably damaging 1.00
IGL02127:Atm APN 9 53487983 missense probably damaging 1.00
IGL02175:Atm APN 9 53480665 missense probably damaging 0.99
IGL02246:Atm APN 9 53527185 missense probably benign 0.12
IGL02259:Atm APN 9 53518494 splice site probably benign
IGL02351:Atm APN 9 53522176 missense probably benign 0.04
IGL02358:Atm APN 9 53522176 missense probably benign 0.04
IGL02387:Atm APN 9 53479766 splice site probably null
IGL02417:Atm APN 9 53479695 missense probably benign 0.00
IGL02422:Atm APN 9 53500792 missense probably damaging 1.00
IGL02445:Atm APN 9 53454330 missense probably benign 0.00
IGL02492:Atm APN 9 53455859 missense probably damaging 0.99
IGL02513:Atm APN 9 53497262 splice site probably benign
IGL02633:Atm APN 9 53448153 missense probably damaging 1.00
IGL02634:Atm APN 9 53516563 missense probably benign 0.00
IGL02948:Atm APN 9 53453440 splice site probably benign
IGL02959:Atm APN 9 53471418 missense probably damaging 1.00
IGL02965:Atm APN 9 53453563 missense probably damaging 1.00
IGL03085:Atm APN 9 53484171 missense possibly damaging 0.89
antebellum UTSW 9 53518559 nonsense probably null
civil UTSW 9 53492268 missense possibly damaging 0.78
mockingbird UTSW 9 53516467 nonsense probably null
mockingbird2 UTSW 9 53488587 missense probably damaging 1.00
Strato UTSW 9 53503018 missense probably damaging 1.00
tropo UTSW 9 53531648 missense probably damaging 1.00
P0019:Atm UTSW 9 53465028 splice site probably benign
PIT4403001:Atm UTSW 9 53500982 missense probably benign
PIT4687001:Atm UTSW 9 53486812 critical splice donor site probably null
R0004:Atm UTSW 9 53453528 splice site probably benign
R0035:Atm UTSW 9 53513180 missense probably benign 0.01
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0098:Atm UTSW 9 53518569 missense probably benign 0.10
R0201:Atm UTSW 9 53454279 splice site probably benign
R0304:Atm UTSW 9 53516344 missense probably benign 0.34
R0308:Atm UTSW 9 53454473 intron probably null
R0362:Atm UTSW 9 53458838 missense possibly damaging 0.90
R0470:Atm UTSW 9 53460966 missense probably damaging 1.00
R0513:Atm UTSW 9 53503948 missense probably benign 0.00
R0589:Atm UTSW 9 53490192 missense possibly damaging 0.51
R0617:Atm UTSW 9 53458941 nonsense probably null
R0630:Atm UTSW 9 53531622 splice site probably benign
R0652:Atm UTSW 9 53486014 missense probably damaging 0.98
R0698:Atm UTSW 9 53515239 missense probably damaging 1.00
R0737:Atm UTSW 9 53456566 missense probably damaging 1.00
R0885:Atm UTSW 9 53459823 missense probably benign
R0947:Atm UTSW 9 53504092 missense probably benign 0.01
R0948:Atm UTSW 9 53495958 missense probably benign
R1144:Atm UTSW 9 53511698 splice site probably benign
R1252:Atm UTSW 9 53455840 missense probably damaging 1.00
R1295:Atm UTSW 9 53456530 missense probably damaging 1.00
R1296:Atm UTSW 9 53456530 missense probably damaging 1.00
R1419:Atm UTSW 9 53457489 missense probably benign 0.00
R1477:Atm UTSW 9 53464273 missense probably benign 0.00
R1596:Atm UTSW 9 53453378 missense probably damaging 1.00
R1630:Atm UTSW 9 53479673 missense probably damaging 0.99
R1667:Atm UTSW 9 53500932 missense probably damaging 1.00
R1681:Atm UTSW 9 53522155 missense possibly damaging 0.94
R1703:Atm UTSW 9 53500700 missense probably benign
R1817:Atm UTSW 9 53492233 splice site probably benign
R1840:Atm UTSW 9 53456530 missense probably damaging 1.00
R1848:Atm UTSW 9 53468012 missense probably benign 0.06
R1906:Atm UTSW 9 53506568 missense probably damaging 1.00
R1958:Atm UTSW 9 53471418 missense probably damaging 1.00
R2108:Atm UTSW 9 53443997 missense probably damaging 1.00
R2116:Atm UTSW 9 53500969 missense probably benign 0.36
R2134:Atm UTSW 9 53467964 critical splice donor site probably null
R2137:Atm UTSW 9 53453375 missense probably damaging 1.00
R2291:Atm UTSW 9 53490909 splice site probably null
R2348:Atm UTSW 9 53492268 missense possibly damaging 0.78
R2483:Atm UTSW 9 53510266 missense probably damaging 1.00
R2567:Atm UTSW 9 53457470 missense possibly damaging 0.72
R2897:Atm UTSW 9 53507805 missense probably damaging 0.99
R2939:Atm UTSW 9 53494711 missense probably damaging 1.00
R3008:Atm UTSW 9 53480750 missense probably benign 0.00
R3236:Atm UTSW 9 53479748 missense probably benign 0.15
R3847:Atm UTSW 9 53503075 missense possibly damaging 0.94
R3889:Atm UTSW 9 53506636 splice site probably benign
R3919:Atm UTSW 9 53492278 missense probably benign 0.00
R4125:Atm UTSW 9 53450621 missense probably damaging 1.00
R4222:Atm UTSW 9 53480669 missense probably benign
R4395:Atm UTSW 9 53465227 missense probably benign 0.09
R4466:Atm UTSW 9 53448169 nonsense probably null
R4502:Atm UTSW 9 53495946 missense possibly damaging 0.92
R4514:Atm UTSW 9 53493039 missense probably damaging 0.99
R4528:Atm UTSW 9 53500759 missense probably benign 0.39
R4593:Atm UTSW 9 53453594 missense possibly damaging 0.55
R4627:Atm UTSW 9 53456506 missense possibly damaging 0.79
R4634:Atm UTSW 9 53531733 missense probably benign 0.01
R4665:Atm UTSW 9 53464229 missense probably benign 0.00
R4672:Atm UTSW 9 53522201 missense probably damaging 0.99
R4741:Atm UTSW 9 53453607 missense probably benign 0.10
R4808:Atm UTSW 9 53445495 missense probably damaging 0.99
R4959:Atm UTSW 9 53515301 missense probably benign
R4996:Atm UTSW 9 53524507 missense probably benign 0.09
R5030:Atm UTSW 9 53520109 nonsense probably null
R5214:Atm UTSW 9 53491027 missense probably benign 0.09
R5260:Atm UTSW 9 53506611 missense probably damaging 0.99
R5311:Atm UTSW 9 53518623 missense probably benign 0.00
R5394:Atm UTSW 9 53507777 critical splice donor site probably null
R5400:Atm UTSW 9 53503018 missense probably damaging 1.00
R5436:Atm UTSW 9 53459804 missense probably benign 0.00
R5441:Atm UTSW 9 53516467 nonsense probably null
R5569:Atm UTSW 9 53516450 nonsense probably null
R5856:Atm UTSW 9 53495955 missense possibly damaging 0.64
R5891:Atm UTSW 9 53497159 missense probably benign
R5910:Atm UTSW 9 53448080 missense probably damaging 0.96
R6054:Atm UTSW 9 53459873 missense probably damaging 1.00
R6062:Atm UTSW 9 53488587 missense probably damaging 1.00
R6092:Atm UTSW 9 53524414 missense probably damaging 1.00
R6127:Atm UTSW 9 53524509 missense probably damaging 1.00
R6160:Atm UTSW 9 53490959 missense probably benign 0.04
R6267:Atm UTSW 9 53444000 missense probably damaging 1.00
R6273:Atm UTSW 9 53487922 missense probably benign 0.09
R6284:Atm UTSW 9 53445376 splice site probably null
R6478:Atm UTSW 9 53490254 missense probably damaging 1.00
R6547:Atm UTSW 9 53440157 missense probably damaging 1.00
R6549:Atm UTSW 9 53493177 missense probably benign 0.00
R6704:Atm UTSW 9 53458853 missense probably benign 0.02
R6715:Atm UTSW 9 53531648 missense probably damaging 1.00
R6737:Atm UTSW 9 53486051 missense probably benign 0.30
R6759:Atm UTSW 9 53518559 nonsense probably null
R6766:Atm UTSW 9 53490282 missense probably damaging 0.99
R6813:Atm UTSW 9 53497235 missense probably benign 0.00
R6852:Atm UTSW 9 53482430 missense possibly damaging 0.93
R7064:Atm UTSW 9 53507881 missense probably benign 0.02
R7208:Atm UTSW 9 53512008 intron probably null
R7211:Atm UTSW 9 53488560 missense probably benign 0.01
R7220:Atm UTSW 9 53511917 nonsense probably null
R7336:Atm UTSW 9 53462503 missense possibly damaging 0.47
R7363:Atm UTSW 9 53465298 missense probably damaging 1.00
R7378:Atm UTSW 9 53453437 critical splice acceptor site probably null
X0067:Atm UTSW 9 53479694 missense probably benign 0.00
Z1088:Atm UTSW 9 53531687 missense probably damaging 1.00
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:31 PM by Diantha La Vine
Record Created 2019-01-15 8:13 PM by Bruce Beutler
Record Posted 2019-02-08
Phenotypic Description

Figure 1. Osphere mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequencies. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Osphere mice exhibit increased frequencies of B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Osphere mice exhibited diminished IL-1β secretion in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Osphere mice exhibit decreased phagocytosis of peritoneal exudate cells. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The osphere phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1630, some of which showed increased B to T cell ratios (Figure 1), increased frequencies of peripheral blood B1 cells (Figure 2), reduced secretion of the proinflammatory cytokine interleukin (IL)-1β in response to priming with lipopolysaccharide (LPS) followed by nigericin treatment (i.e., NLRP3 inflammasome signaling defect; Figure 3), and defective phagocytosis of peritoneal exudate cells (Figure 4). Phagocytosis was detected by measuring the fluorescence intensity of pHrodo® Green E. coliconjugates two hours after treatment of PECs with an experimental phagocytosis effector (e.g., Cytochalasin D). The pHrodo® Green E. coli conjugates fluoresce at acidic pH, such as in phagosomes. 

Nature of Mutation

Figure 5. Linkage mapping of the increased B1 cell frequency using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 61 mutations (X-axis) identified in the G1 male of pedigree R1630. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 61 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 9: Atm and Dennd4a. The mutation in Atm was presumed causative as the immune phenotypes observed in tropo mice mimics that of other mice expressing mutant Atm alleles (see MGI). The mutation in Atm is a T to A transversion at base pair 53,479,673 (v38) on chromosome 9, or base pair 57,144 in the GenBank genomic region NC_000075. The strongest association was found with a recessive model of inheritance to the B1 cell phenotype, wherein two variant homozygotes departed phenotypically from five homozygous reference mice and seven heterozygous mice with a P value of 3.837 x 10-6  (Figure 5).  

 

The mutation corresponds to residue 5,739 in the mRNA sequence NM_007499 within exon 36 of 64 total exons.


 

5723 GAATCGTGGAGAACTCTGCTGTCTGCGCACGTC

1862 -E--S--W--R--T--L--L--S--A--H--V-

 

The mutated nucleotide is indicated in red. The mutation results in a leucine to glutamine substitution at amino acid 1,867 (L1867Q) in the ATM protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 0.994).

Protein Prediction

Figure 6. Domain organization of ATM. The location of the osphere mutation is indicated. Mutations found in ATM are noted in red. Click on each mutation to view more information.

ATM (ataxia telangiectasia mutated) is a member of the PI3/PI4-kinase (PIKK) family. The PIKK family members DNA-PKCS (DNA-dependent protein kinase; see clover), ATR (ATM and Rad3-related), and ATM are involved in DNA repair [(1); reviewed in (2)]. A 250-amino acid region at the C-terminus of ATM constitutes the catalytic PIKK domain (Figure 6). The PIKK domain is flanked by the FAT domain (named for its homology to FRAP, ATM and TRRAP) and a FATC domain (FAT at the extreme C-terminus). The FAT and FATC domains occur in combination in all PIKK family members, suggesting a possible role in maintaining a structural conformation essential for the activation of the catalytic site (3;4). The FAT domain mediates ATM dimerization and has three tetratriocpeptide repeat domains (TRDs). The N-terminal portion of the protein up to the FAT domain consists of HEAT (Huntingtin, Elongation factor 3, A subunit of protein phosphatase 2A and TOR1) repeats (5). HEAT repeats are helical structural repeats that mediate protein-protein interactions (6).

 

The osphere mutation results in a leucine to glutamine substitution at amino acid 1,867 (L1867Q); amino acid 1,867 is within the HEAT repeat region.

 

For more information about Atm, please see the record for mockingbird.

Putative Mechanism

ATM is a cell cycle checkpoint kinase that phosphorylates proteins in several cell processes, including DNA repair, apoptosis, cell cycle checkpoints, telomere dysfunction, translation initiation, gene regulation, mitosis, and hypoxia. In all, there are 900 putative ATM/ATR phosphorylation sites on over 700 proteins in the DNA damage response (DDR) pathway alone (7).

 

Mutations in human ATM are linked to ataxia-telangiectasia [OMIM: #208900; (8;9)] and susceptibility to breast cancer (OMIM: #114480) as well as somatic B-cell non-Hodgkin lymphoma, somatic mantle cell lymphoma, and somatic T-cell prolymphocytic leukemia. Ataxia-telangiectasia is characterized by progressive cerebellar ataxia due to premature degeneration of Purkinje and granule cells, telangiectasia (dilated blood vessels), growth retardation, gonadal atrophy, immune defects, and a predisposition to malignancy (lymphoma, leukemia, and breast cancer). Fibroblasts from ataxia-telangiectasia patients exhibit aberrant gross morphology and cytoskeletal organization, poor cell growth, defective cell-cycle checkpoints, telomere loss, and chromosome end-to-end associations.

 

Atm­-deficient (Atm-/-) mice exhibited reduced body weights, increased incidence of T-cell-derived lymphoma, premature death (median survival is 113 days), reduced numbers of CD4+ and CD8+ T cells, reduced numbers of CD3/CD4 and CD3/CD8 T cells, reduced numbers of active T cells, reduced numbers of pre-B cells, reduced levels of IgG, male and female infertility, hypoactivity, impaired coordination, impaired glucose tolerance, and insulin resistance (10-18). B cells from the Atm-/- mice exhibited reduced class switch recombination with increased genomic instability after tamoxifen treatment compared to cells from wild-type mice (19). Homozygous mice expressing a kinase dead mutant Atm allele exhibited embryonic lethality from embryonic day (E) 9.5 to E10.5 (19). Homozygous mice expressing a mutant Atm allele (a 9 base pair in-frame deletion in exon 54 resulting in deletion of Ser2556-Arg2557-Iso2558 in the protein) exhibited premature death by 40 weeks of age (50%), reduced body size, increased tumor incidence, increased numbers of double-negative and single-positive T cells, reduced thymocyte numbers, and male infertility (16). The phenotype of the osphere mice indicates loss of ATM-associated function.

Primers PCR Primer
osphere(F):5'- ACAATGCCTGGTGTAAGGAGTGTG -3'
osphere(R):5'- AGGTCGGAAACCCTTTGCTTGG -3'

Sequencing Primer
osphere_seq(F):5'- GTGTGCAGAAAGTTGCCC -3'
osphere_seq(R):5'- GAAACCCTTTGCTTGGTATTGC -3'
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 474 nucleotides is amplified (chromosome 9, - strand):


1   aggtcggaaa ccctttgctt ggtattgctg ggttgttttt gttctgttct gtttttcttt
61  attttaatca ctactagata cacacttttg cttgttgtag tttttaattg atctgtcagg
121 ggaatgaacc ttttcagtaa atgatgttac tctaattcaa acaattgagt ggatatatgc
181 catgtcctag gtgaaaaccg acttctgtca gatgttgctg ccatacttga tccatgatgt
241 tttactgcaa gatacacatg aatcgtggag aactctgctg tctgcgcacg tccgaggatt
301 tttcactagt tgttttaagc attcctccca agcaagccgc tcagcaactc ctgcaaattc
361 ggattcaggt atcctgtttg ttagtgttta taccgttagc atctcagctc tagagaaaga
421 tggttccgta agttacaggg caactttctg cacactcctt acaccaggca ttgt


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler