Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4687001:Atm'

556193

Institutional Source

Beutler Lab

Gene Symbol

Atm

Ensembl Gene

ENSMUSG00000034218

Gene Name

ataxia telangiectasia mutated

Synonyms

C030026E19Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.905) question?

Stock #

PIT4687001 (G1)

Quality Score

154.008

Status

Not validated

Chromosome

Chromosomal Location

53350449-53448040 bp(-) (GRCm39)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 53398112 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118282] [ENSMUST00000232179]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000118282

SMART Domains

Protein: ENSMUSP00000113388
Gene: ENSMUSG00000034218

Domain	Start	End	E-Value	Type
TAN	1	166	5.07e-68	SMART
low complexity region	431	445	N/A	INTRINSIC
low complexity region	830	846	N/A	INTRINSIC
low complexity region	929	940	N/A	INTRINSIC
SCOP:d1gw5a_	1039	1568	2e-4	SMART
coiled coil region	1615	1644	N/A	INTRINSIC
low complexity region	1650	1662	N/A	INTRINSIC
Pfam:FAT	2102	2499	4.4e-50	PFAM
low complexity region	2587	2599	N/A	INTRINSIC
PI3Kc	2723	3026	1.11e-117	SMART
FATC	3034	3066	3.71e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000232179

Coding Region Coverage

1x: 93.4%
3x: 90.8%
10x: 84.7%
20x: 71.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for null mutations may exhibit locomotor abnormalities, motor learning deficits, growth retardation, sterility due to meiotic arrest, and susceptibility to thymic lymphomas. Mice homozygous for a kinase dead allele exhibit early embryonic lethality associated with genetic instability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adh1	T	G	3: 137,995,596 (GRCm39)	V333G	probably damaging	Het
Aggf1	A	G	13: 95,501,383 (GRCm39)	L333P	probably damaging	Het
Ankmy1	A	G	1: 92,812,803 (GRCm39)	V502A	probably benign	Het
Ccdc180	A	G	4: 45,949,526 (GRCm39)	T1594A	probably damaging	Het
Cep290	T	A	10: 100,373,453 (GRCm39)	D1244E	probably benign	Het
Ctnna3	A	G	10: 64,670,385 (GRCm39)	D638G	probably damaging	Het
Ctsr	T	C	13: 61,308,346 (GRCm39)	H266R	possibly damaging	Het
D630045J12Rik	C	T	6: 38,172,036 (GRCm39)	E711K	probably benign	Het
Dnah5	T	C	15: 28,383,723 (GRCm39)	S2982P	probably damaging	Het
Dsg1a	G	T	18: 20,464,755 (GRCm39)	A417S	probably benign	Het
Gdpd1	T	C	11: 86,950,366 (GRCm39)	D69G	probably damaging	Het
Gp2	C	T	7: 119,050,801 (GRCm39)	R310H	possibly damaging	Het
Ifna2	G	A	4: 88,601,542 (GRCm39)	H159Y	possibly damaging	Het
Kptn	T	C	7: 15,859,751 (GRCm39)	V325A	probably damaging	Het
Marchf7	A	G	2: 60,062,622 (GRCm39)	E143G	probably damaging	Het
Mcm4	A	G	16: 15,454,577 (GRCm39)	L47P	probably benign	Het
Mcm8	T	C	2: 132,659,097 (GRCm39)	F27S	possibly damaging	Het
Nod2	T	A	8: 89,408,274 (GRCm39)	V967E	probably damaging	Het
Nrxn2	G	A	19: 6,531,338 (GRCm39)	R659Q	probably benign	Het
Or10al4	T	G	17: 38,037,082 (GRCm39)	C56G	probably benign	Het
Or4x12-ps1	A	G	2: 89,916,733 (GRCm39)	V24A	probably benign	Het
Parp10	C	T	15: 76,125,122 (GRCm39)	R545Q	probably benign	Het
Ppp2r3d	T	C	9: 101,021,579 (GRCm39)	E332G	probably benign	Het
Pramel27	C	T	4: 143,573,103 (GRCm39)		probably benign	Het
Ptpdc1	A	G	13: 48,739,766 (GRCm39)	V555A	probably benign	Het
Qsox2	G	A	2: 26,112,300 (GRCm39)	L81F	possibly damaging	Het
Sbsn	GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA	GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA	7: 30,452,391 (GRCm39)		probably benign	Het
Spata31	A	G	13: 65,069,151 (GRCm39)	D433G	probably benign	Het
Stpg2	T	C	3: 138,921,026 (GRCm39)	I77T	possibly damaging	Het
Sugp2	T	C	8: 70,710,162 (GRCm39)	S928P	probably damaging	Het
Syne1	A	G	10: 5,308,390 (GRCm39)	S722P	possibly damaging	Het
Szt2	A	T	4: 118,255,398 (GRCm39)	S229T	possibly damaging	Het
Tm9sf3	A	G	19: 41,206,630 (GRCm39)	L505P	probably damaging	Het
Ttc39d	G	A	17: 80,524,354 (GRCm39)	A338T	probably damaging	Het
Ubash3b	A	G	9: 40,934,814 (GRCm39)	F489L	probably damaging	Het
Xpo7	A	T	14: 70,904,589 (GRCm39)	Y1015N	probably benign	Het
Zbtb14	C	A	17: 69,695,302 (GRCm39)	Y333*	probably null	Het
Zp2	T	C	7: 119,741,102 (GRCm39)	T141A	probably benign	Het

Other mutations in Atm

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Atm	APN	9	53,435,743 (GRCm39)	missense	probably damaging	1.00
IGL00466:Atm	APN	9	53,410,412 (GRCm39)	splice site	probably benign
IGL00567:Atm	APN	9	53,414,416 (GRCm39)	nonsense	probably null
IGL00702:Atm	APN	9	53,423,131 (GRCm39)	missense	probably benign	0.02
IGL00743:Atm	APN	9	53,424,416 (GRCm39)	missense	probably benign	0.00
IGL00771:Atm	APN	9	53,404,354 (GRCm39)	missense	probably benign	0.01
IGL00773:Atm	APN	9	53,433,444 (GRCm39)	missense	probably benign	0.00
IGL00819:Atm	APN	9	53,429,831 (GRCm39)	missense	probably damaging	1.00
IGL00864:Atm	APN	9	53,445,233 (GRCm39)	missense	probably damaging	0.99
IGL00985:Atm	APN	9	53,371,116 (GRCm39)	missense	probably damaging	0.98
IGL01109:Atm	APN	9	53,401,593 (GRCm39)	missense	probably damaging	1.00
IGL01120:Atm	APN	9	53,372,422 (GRCm39)	critical splice acceptor site	probably null
IGL01369:Atm	APN	9	53,426,617 (GRCm39)	missense	probably benign
IGL01374:Atm	APN	9	53,443,024 (GRCm39)	missense	possibly damaging	0.58
IGL01406:Atm	APN	9	53,351,046 (GRCm39)	makesense	probably null
IGL01409:Atm	APN	9	53,410,471 (GRCm39)	missense	probably benign	0.01
IGL01434:Atm	APN	9	53,419,107 (GRCm39)	missense	probably benign	0.04
IGL01486:Atm	APN	9	53,421,513 (GRCm39)	missense	probably benign
IGL01583:Atm	APN	9	53,395,547 (GRCm39)	splice site	probably benign
IGL01861:Atm	APN	9	53,405,912 (GRCm39)	missense	probably null	0.89
IGL01865:Atm	APN	9	53,372,302 (GRCm39)	missense	probably damaging	1.00
IGL02026:Atm	APN	9	53,353,717 (GRCm39)	splice site	probably null
IGL02072:Atm	APN	9	53,371,096 (GRCm39)	missense	probably benign	0.01
IGL02075:Atm	APN	9	53,438,537 (GRCm39)	missense	probably damaging	1.00
IGL02127:Atm	APN	9	53,399,283 (GRCm39)	missense	probably damaging	1.00
IGL02175:Atm	APN	9	53,391,965 (GRCm39)	missense	probably damaging	0.99
IGL02246:Atm	APN	9	53,438,485 (GRCm39)	missense	probably benign	0.12
IGL02259:Atm	APN	9	53,429,794 (GRCm39)	splice site	probably benign
IGL02351:Atm	APN	9	53,433,476 (GRCm39)	missense	probably benign	0.04
IGL02358:Atm	APN	9	53,433,476 (GRCm39)	missense	probably benign	0.04
IGL02387:Atm	APN	9	53,391,066 (GRCm39)	splice site	probably null
IGL02417:Atm	APN	9	53,390,995 (GRCm39)	missense	probably benign	0.00
IGL02422:Atm	APN	9	53,412,092 (GRCm39)	missense	probably damaging	1.00
IGL02445:Atm	APN	9	53,365,630 (GRCm39)	missense	probably benign	0.00
IGL02492:Atm	APN	9	53,367,159 (GRCm39)	missense	probably damaging	0.99
IGL02513:Atm	APN	9	53,408,562 (GRCm39)	splice site	probably benign
IGL02633:Atm	APN	9	53,359,453 (GRCm39)	missense	probably damaging	1.00
IGL02634:Atm	APN	9	53,427,863 (GRCm39)	missense	probably benign	0.00
IGL02948:Atm	APN	9	53,364,740 (GRCm39)	splice site	probably benign
IGL02959:Atm	APN	9	53,382,718 (GRCm39)	missense	probably damaging	1.00
IGL02965:Atm	APN	9	53,364,863 (GRCm39)	missense	probably damaging	1.00
IGL03085:Atm	APN	9	53,395,471 (GRCm39)	missense	possibly damaging	0.89
antebellum	UTSW	9	53,429,859 (GRCm39)	nonsense	probably null
bull_run	UTSW	9	53,399,222 (GRCm39)	missense	probably benign	0.09
Civil	UTSW	9	53,403,568 (GRCm39)	missense	possibly damaging	0.78
gettysburg	UTSW	9	53,367,288 (GRCm39)	splice site	probably null
Grant	UTSW	9	53,423,217 (GRCm39)	nonsense	probably null
Indicative	UTSW	9	53,356,676 (GRCm39)	splice site	probably null
Marker	UTSW	9	53,365,579 (GRCm39)	splice site	probably benign
maunder	UTSW	9	53,410,497 (GRCm39)	nonsense	probably null
mockingbird	UTSW	9	53,427,767 (GRCm39)	nonsense	probably null
mockingbird2	UTSW	9	53,399,887 (GRCm39)	missense	probably damaging	1.00
osphere	UTSW	9	53,390,973 (GRCm39)	missense	probably damaging	0.99
shiloh	UTSW	9	53,376,598 (GRCm39)	missense	probably damaging	1.00
Strato	UTSW	9	53,414,318 (GRCm39)	missense	probably damaging	1.00
thrasher	UTSW	9	53,356,807 (GRCm39)	missense	probably benign	0.01
Tropo	UTSW	9	53,442,948 (GRCm39)	missense	probably damaging	1.00
P0019:Atm	UTSW	9	53,376,328 (GRCm39)	splice site	probably benign
PIT4403001:Atm	UTSW	9	53,412,282 (GRCm39)	missense	probably benign
R0004:Atm	UTSW	9	53,364,828 (GRCm39)	splice site	probably benign
R0035:Atm	UTSW	9	53,424,480 (GRCm39)	missense	probably benign	0.01
R0098:Atm	UTSW	9	53,429,869 (GRCm39)	missense	probably benign	0.10
R0098:Atm	UTSW	9	53,429,869 (GRCm39)	missense	probably benign	0.10
R0201:Atm	UTSW	9	53,365,579 (GRCm39)	splice site	probably benign
R0304:Atm	UTSW	9	53,427,644 (GRCm39)	missense	probably benign	0.34
R0308:Atm	UTSW	9	53,365,773 (GRCm39)	splice site	probably null
R0362:Atm	UTSW	9	53,370,138 (GRCm39)	missense	possibly damaging	0.90
R0470:Atm	UTSW	9	53,372,266 (GRCm39)	missense	probably damaging	1.00
R0513:Atm	UTSW	9	53,415,248 (GRCm39)	missense	probably benign	0.00
R0589:Atm	UTSW	9	53,401,492 (GRCm39)	missense	possibly damaging	0.51
R0617:Atm	UTSW	9	53,370,241 (GRCm39)	nonsense	probably null
R0630:Atm	UTSW	9	53,442,922 (GRCm39)	splice site	probably benign
R0652:Atm	UTSW	9	53,397,314 (GRCm39)	missense	probably damaging	0.98
R0698:Atm	UTSW	9	53,426,539 (GRCm39)	missense	probably damaging	1.00
R0737:Atm	UTSW	9	53,367,866 (GRCm39)	missense	probably damaging	1.00
R0885:Atm	UTSW	9	53,371,123 (GRCm39)	missense	probably benign
R0947:Atm	UTSW	9	53,415,392 (GRCm39)	missense	probably benign	0.01
R0948:Atm	UTSW	9	53,407,258 (GRCm39)	missense	probably benign
R1144:Atm	UTSW	9	53,422,998 (GRCm39)	splice site	probably benign
R1252:Atm	UTSW	9	53,367,140 (GRCm39)	missense	probably damaging	1.00
R1295:Atm	UTSW	9	53,367,830 (GRCm39)	missense	probably damaging	1.00
R1296:Atm	UTSW	9	53,367,830 (GRCm39)	missense	probably damaging	1.00
R1419:Atm	UTSW	9	53,368,789 (GRCm39)	missense	probably benign	0.00
R1477:Atm	UTSW	9	53,375,573 (GRCm39)	missense	probably benign	0.00
R1596:Atm	UTSW	9	53,364,678 (GRCm39)	missense	probably damaging	1.00
R1630:Atm	UTSW	9	53,390,973 (GRCm39)	missense	probably damaging	0.99
R1667:Atm	UTSW	9	53,412,232 (GRCm39)	missense	probably damaging	1.00
R1681:Atm	UTSW	9	53,433,455 (GRCm39)	missense	possibly damaging	0.94
R1703:Atm	UTSW	9	53,412,000 (GRCm39)	missense	probably benign
R1817:Atm	UTSW	9	53,403,533 (GRCm39)	splice site	probably benign
R1840:Atm	UTSW	9	53,367,830 (GRCm39)	missense	probably damaging	1.00
R1848:Atm	UTSW	9	53,379,312 (GRCm39)	missense	probably benign	0.06
R1906:Atm	UTSW	9	53,417,868 (GRCm39)	missense	probably damaging	1.00
R1958:Atm	UTSW	9	53,382,718 (GRCm39)	missense	probably damaging	1.00
R2108:Atm	UTSW	9	53,355,297 (GRCm39)	missense	probably damaging	1.00
R2116:Atm	UTSW	9	53,412,269 (GRCm39)	missense	probably benign	0.36
R2134:Atm	UTSW	9	53,379,264 (GRCm39)	critical splice donor site	probably null
R2137:Atm	UTSW	9	53,364,675 (GRCm39)	missense	probably damaging	1.00
R2291:Atm	UTSW	9	53,402,209 (GRCm39)	splice site	probably null
R2348:Atm	UTSW	9	53,403,568 (GRCm39)	missense	possibly damaging	0.78
R2483:Atm	UTSW	9	53,421,566 (GRCm39)	missense	probably damaging	1.00
R2567:Atm	UTSW	9	53,368,770 (GRCm39)	missense	possibly damaging	0.72
R2897:Atm	UTSW	9	53,419,105 (GRCm39)	missense	probably damaging	0.99
R2939:Atm	UTSW	9	53,406,011 (GRCm39)	missense	probably damaging	1.00
R3008:Atm	UTSW	9	53,392,050 (GRCm39)	missense	probably benign	0.00
R3236:Atm	UTSW	9	53,391,048 (GRCm39)	missense	probably benign	0.15
R3847:Atm	UTSW	9	53,414,375 (GRCm39)	missense	possibly damaging	0.94
R3889:Atm	UTSW	9	53,417,936 (GRCm39)	splice site	probably benign
R3919:Atm	UTSW	9	53,403,578 (GRCm39)	missense	probably benign	0.00
R4125:Atm	UTSW	9	53,361,921 (GRCm39)	missense	probably damaging	1.00
R4222:Atm	UTSW	9	53,391,969 (GRCm39)	missense	probably benign
R4395:Atm	UTSW	9	53,376,527 (GRCm39)	missense	probably benign	0.09
R4466:Atm	UTSW	9	53,359,469 (GRCm39)	nonsense	probably null
R4502:Atm	UTSW	9	53,407,246 (GRCm39)	missense	possibly damaging	0.92
R4514:Atm	UTSW	9	53,404,339 (GRCm39)	missense	probably damaging	0.99
R4528:Atm	UTSW	9	53,412,059 (GRCm39)	missense	probably benign	0.39
R4593:Atm	UTSW	9	53,364,894 (GRCm39)	missense	possibly damaging	0.55
R4627:Atm	UTSW	9	53,367,806 (GRCm39)	missense	possibly damaging	0.79
R4634:Atm	UTSW	9	53,443,033 (GRCm39)	missense	probably benign	0.01
R4665:Atm	UTSW	9	53,375,529 (GRCm39)	missense	probably benign	0.00
R4672:Atm	UTSW	9	53,433,501 (GRCm39)	missense	probably damaging	0.99
R4741:Atm	UTSW	9	53,364,907 (GRCm39)	missense	probably benign	0.10
R4808:Atm	UTSW	9	53,356,795 (GRCm39)	missense	probably damaging	0.99
R4959:Atm	UTSW	9	53,426,601 (GRCm39)	missense	probably benign
R4996:Atm	UTSW	9	53,435,807 (GRCm39)	missense	probably benign	0.09
R5030:Atm	UTSW	9	53,431,409 (GRCm39)	nonsense	probably null
R5214:Atm	UTSW	9	53,402,327 (GRCm39)	missense	probably benign	0.09
R5260:Atm	UTSW	9	53,417,911 (GRCm39)	missense	probably damaging	0.99
R5311:Atm	UTSW	9	53,429,923 (GRCm39)	missense	probably benign	0.00
R5394:Atm	UTSW	9	53,419,077 (GRCm39)	critical splice donor site	probably null
R5400:Atm	UTSW	9	53,414,318 (GRCm39)	missense	probably damaging	1.00
R5436:Atm	UTSW	9	53,371,104 (GRCm39)	missense	probably benign	0.00
R5441:Atm	UTSW	9	53,427,767 (GRCm39)	nonsense	probably null
R5569:Atm	UTSW	9	53,427,750 (GRCm39)	nonsense	probably null
R5856:Atm	UTSW	9	53,407,255 (GRCm39)	missense	possibly damaging	0.64
R5891:Atm	UTSW	9	53,408,459 (GRCm39)	missense	probably benign
R5910:Atm	UTSW	9	53,359,380 (GRCm39)	missense	probably damaging	0.96
R6054:Atm	UTSW	9	53,371,173 (GRCm39)	missense	probably damaging	1.00
R6062:Atm	UTSW	9	53,399,887 (GRCm39)	missense	probably damaging	1.00
R6092:Atm	UTSW	9	53,435,714 (GRCm39)	missense	probably damaging	1.00
R6127:Atm	UTSW	9	53,435,809 (GRCm39)	missense	probably damaging	1.00
R6160:Atm	UTSW	9	53,402,259 (GRCm39)	missense	probably benign	0.04
R6267:Atm	UTSW	9	53,355,300 (GRCm39)	missense	probably damaging	1.00
R6273:Atm	UTSW	9	53,399,222 (GRCm39)	missense	probably benign	0.09
R6284:Atm	UTSW	9	53,356,676 (GRCm39)	splice site	probably null
R6478:Atm	UTSW	9	53,401,554 (GRCm39)	missense	probably damaging	1.00
R6547:Atm	UTSW	9	53,351,457 (GRCm39)	missense	probably damaging	1.00
R6549:Atm	UTSW	9	53,404,477 (GRCm39)	missense	probably benign	0.00
R6704:Atm	UTSW	9	53,370,153 (GRCm39)	missense	probably benign	0.02
R6715:Atm	UTSW	9	53,442,948 (GRCm39)	missense	probably damaging	1.00
R6737:Atm	UTSW	9	53,397,351 (GRCm39)	missense	probably benign	0.30
R6759:Atm	UTSW	9	53,429,859 (GRCm39)	nonsense	probably null
R6766:Atm	UTSW	9	53,401,582 (GRCm39)	missense	probably damaging	0.99
R6813:Atm	UTSW	9	53,408,535 (GRCm39)	missense	probably benign	0.00
R6852:Atm	UTSW	9	53,393,730 (GRCm39)	missense	possibly damaging	0.93
R7064:Atm	UTSW	9	53,419,181 (GRCm39)	missense	probably benign	0.02
R7208:Atm	UTSW	9	53,423,308 (GRCm39)	splice site	probably null
R7211:Atm	UTSW	9	53,399,860 (GRCm39)	missense	probably benign	0.01
R7220:Atm	UTSW	9	53,423,217 (GRCm39)	nonsense	probably null
R7336:Atm	UTSW	9	53,373,803 (GRCm39)	missense	possibly damaging	0.47
R7363:Atm	UTSW	9	53,376,598 (GRCm39)	missense	probably damaging	1.00
R7378:Atm	UTSW	9	53,364,737 (GRCm39)	critical splice acceptor site	probably null
R7472:Atm	UTSW	9	53,359,425 (GRCm39)	missense	possibly damaging	0.81
R7487:Atm	UTSW	9	53,435,654 (GRCm39)	missense	probably benign
R7497:Atm	UTSW	9	53,423,191 (GRCm39)	missense	probably benign	0.00
R7584:Atm	UTSW	9	53,424,427 (GRCm39)	missense	probably damaging	0.99
R7624:Atm	UTSW	9	53,366,068 (GRCm39)	missense	probably damaging	0.99
R7653:Atm	UTSW	9	53,401,602 (GRCm39)	nonsense	probably null
R7660:Atm	UTSW	9	53,356,807 (GRCm39)	missense	probably benign	0.01
R7679:Atm	UTSW	9	53,353,797 (GRCm39)	missense	probably damaging	1.00
R7720:Atm	UTSW	9	53,433,539 (GRCm39)	missense	possibly damaging	0.54
R8221:Atm	UTSW	9	53,367,288 (GRCm39)	splice site	probably null
R8247:Atm	UTSW	9	53,361,870 (GRCm39)	missense
R8334:Atm	UTSW	9	53,433,573 (GRCm39)	missense	probably benign	0.00
R8503:Atm	UTSW	9	53,399,352 (GRCm39)	missense	probably damaging	0.99
R8552:Atm	UTSW	9	53,435,797 (GRCm39)	missense	probably damaging	1.00
R8749:Atm	UTSW	9	53,410,497 (GRCm39)	nonsense	probably null
R8838:Atm	UTSW	9	53,427,851 (GRCm39)	missense	probably damaging	0.99
R9126:Atm	UTSW	9	53,370,134 (GRCm39)	missense	probably benign	0.01
R9131:Atm	UTSW	9	53,445,044 (GRCm39)	missense	probably benign	0.10
R9191:Atm	UTSW	9	53,438,590 (GRCm39)	missense	probably benign	0.29
R9257:Atm	UTSW	9	53,407,150 (GRCm39)	critical splice donor site	probably null
R9473:Atm	UTSW	9	53,410,272 (GRCm39)	missense	probably benign
R9558:Atm	UTSW	9	53,412,081 (GRCm39)	missense	probably benign	0.00
R9598:Atm	UTSW	9	53,431,381 (GRCm39)	missense	probably benign	0.34
R9717:Atm	UTSW	9	53,427,817 (GRCm39)	missense	probably damaging	1.00
R9794:Atm	UTSW	9	53,429,867 (GRCm39)	missense	probably benign
X0067:Atm	UTSW	9	53,390,994 (GRCm39)	missense	probably benign	0.00
Z1088:Atm	UTSW	9	53,442,987 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGTGGCCTCTCTGTAATG -3'
(R):5'- TTCACTCTTCACAGTTAGCCAG -3'

Sequencing Primer
(F):5'- GATGGCTCATCTGTTAAGAGCAC -3'
(R):5'- TTCACAGTTAGCCAGTACATACTCAG -3'

Posted On

2019-06-07