Incidental Mutation 'R0411:Olfm1'
ID36635
Institutional Source Beutler Lab
Gene Symbol Olfm1
Ensembl Gene ENSMUSG00000026833
Gene Nameolfactomedin 1
SynonymsNoelin 1, Pancortin 1-4, Noelin 2
MMRRC Submission 038613-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0411 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location28192992-28230736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28208211 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 95 (R95K)
Ref Sequence ENSEMBL: ENSMUSP00000099943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028177] [ENSMUST00000100244] [ENSMUST00000102879] [ENSMUST00000113920]
Predicted Effect probably benign
Transcript: ENSMUST00000028177
AA Change: R95K

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028177
Gene: ENSMUSG00000026833
AA Change: R95K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Noelin-1 54 153 1.5e-50 PFAM
Blast:OLF 170 215 1e-5 BLAST
OLF 228 478 5.43e-170 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100244
AA Change: R67K

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097815
Gene: ENSMUSG00000026833
AA Change: R67K

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Noelin-1 25 125 2.6e-53 PFAM
Blast:OLF 142 187 1e-5 BLAST
OLF 200 450 5.43e-170 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102879
AA Change: R95K

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099943
Gene: ENSMUSG00000026833
AA Change: R95K

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Noelin-1 53 153 4.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113920
AA Change: R52K

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109553
Gene: ENSMUSG00000026833
AA Change: R52K

DomainStartEndE-ValueType
Pfam:Noelin-1 10 110 7.4e-53 PFAM
Blast:OLF 127 172 1e-5 BLAST
OLF 185 435 5.43e-170 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152415
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product shares extensive sequence similarity with the rat neuronal olfactomedin-related ER localized protein. While the exact function of the encoded protein is not known, its abundant expression in brain suggests that it may have an essential role in nerve tissue. Several alternatively spliced transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display decreased cerebral infarction size and reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,896,491 probably benign Het
6030469F06Rik A T 12: 31,184,731 noncoding transcript Het
Acad11 T C 9: 104,116,296 F541L probably damaging Het
Acin1 G T 14: 54,646,774 R92S probably damaging Het
Appl1 A G 14: 26,940,256 S490P probably benign Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Arih1 A T 9: 59,485,983 I122N possibly damaging Het
Bmi1 T C 2: 18,683,172 probably benign Het
Bmpr1a G A 14: 34,415,877 T391I possibly damaging Het
Cacna1s A G 1: 136,113,303 K1256E probably damaging Het
Cacng3 C T 7: 122,768,572 P225L probably damaging Het
Cd101 A T 3: 101,018,527 probably null Het
Cd55 A G 1: 130,462,557 probably benign Het
Cenpe T C 3: 135,222,255 I258T probably damaging Het
Cma2 A G 14: 55,973,678 probably benign Het
Ddost T A 4: 138,309,653 S176T probably benign Het
Ddx19b A T 8: 111,023,964 probably null Het
Dmxl2 A G 9: 54,378,939 I2681T probably damaging Het
Ern1 C T 11: 106,398,586 E964K probably benign Het
Galntl5 C T 5: 25,220,174 R430C probably benign Het
Gga3 A G 11: 115,587,433 L511P probably damaging Het
Gm7271 G T 5: 76,500,487 V47L possibly damaging Het
Gria2 C T 3: 80,710,858 probably benign Het
Hmbs A T 9: 44,341,652 L28* probably null Het
Iffo2 A G 4: 139,603,221 E220G probably damaging Het
Ifi30 A G 8: 70,764,918 probably benign Het
Irf2 T A 8: 46,846,061 C297S probably benign Het
Izumo4 T C 10: 80,703,084 Y94H probably damaging Het
Klhdc9 A G 1: 171,359,785 V215A probably benign Het
Kmt2a T C 9: 44,819,964 probably benign Het
Kmt2c A T 5: 25,375,957 C513S probably damaging Het
Lyg1 A T 1: 37,949,896 M81K possibly damaging Het
Maip1 T G 1: 57,415,693 W279G probably damaging Het
Myo7a T C 7: 98,071,937 T1263A probably benign Het
Naa15 T A 3: 51,465,639 I701N possibly damaging Het
Ncoa3 A G 2: 166,068,543 N1292S probably benign Het
Necab2 T A 8: 119,454,240 probably benign Het
Nfatc1 T A 18: 80,698,042 I234F possibly damaging Het
Olfr1118 A G 2: 87,309,058 T90A probably benign Het
Olfr1329 A T 4: 118,916,626 N280K possibly damaging Het
Otoa T C 7: 121,156,527 probably null Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pard6g A G 18: 80,117,122 D150G probably damaging Het
Pax5 A G 4: 44,609,783 L215S probably damaging Het
Pja2 A T 17: 64,287,521 probably benign Het
Plk4 T A 3: 40,811,219 probably benign Het
Polr1a A T 6: 71,978,421 H1687L possibly damaging Het
Ptcd2 G A 13: 99,343,391 L41F probably damaging Het
Ropn1 T A 16: 34,669,964 S62T probably benign Het
Setd1a T C 7: 127,796,051 probably benign Het
Setdb1 T C 3: 95,327,686 D902G probably damaging Het
Sik3 T A 9: 46,208,770 L719Q probably damaging Het
Slc36a1 G T 11: 55,232,507 V433F probably benign Het
Slc6a3 T C 13: 73,557,050 V220A possibly damaging Het
Slc6a5 A T 7: 49,911,791 R24W probably damaging Het
Smox G T 2: 131,520,644 R281L probably benign Het
Sulf2 G T 2: 166,093,516 H226N probably damaging Het
Syne2 C T 12: 76,059,584 probably null Het
Tenm3 C T 8: 48,287,791 S1210N possibly damaging Het
Tns1 A T 1: 73,925,761 V1237E probably damaging Het
Trf C T 9: 103,217,501 V92M probably damaging Het
Ttn A G 2: 76,709,373 V34423A possibly damaging Het
Vmn2r118 A G 17: 55,611,021 probably benign Het
Vmn2r19 A G 6: 123,309,744 Y112C probably damaging Het
Wdr66 C T 5: 123,290,054 T538M probably damaging Het
Zfp326 G T 5: 105,878,775 A15S possibly damaging Het
Other mutations in Olfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Olfm1 APN 2 28214703 missense probably damaging 1.00
IGL01326:Olfm1 APN 2 28229552 missense probably damaging 1.00
IGL01358:Olfm1 APN 2 28229495 missense probably damaging 1.00
IGL02076:Olfm1 APN 2 28222625 missense probably damaging 0.99
IGL02337:Olfm1 APN 2 28229685 missense probably damaging 1.00
IGL02693:Olfm1 APN 2 28212650 missense probably damaging 1.00
IGL02825:Olfm1 APN 2 28229078 missense probably damaging 1.00
IGL02974:Olfm1 APN 2 28229689 missense probably damaging 1.00
R0266:Olfm1 UTSW 2 28229607 missense probably damaging 1.00
R0348:Olfm1 UTSW 2 28212542 missense probably benign 0.26
R0542:Olfm1 UTSW 2 28214628 missense possibly damaging 0.85
R1252:Olfm1 UTSW 2 28229435 missense probably benign 0.01
R1649:Olfm1 UTSW 2 28229267 missense possibly damaging 0.71
R1696:Olfm1 UTSW 2 28208116 nonsense probably null
R1931:Olfm1 UTSW 2 28222662 splice site probably null
R1986:Olfm1 UTSW 2 28214706 missense probably benign 0.13
R3749:Olfm1 UTSW 2 28208088 missense probably damaging 0.96
R3913:Olfm1 UTSW 2 28208174 missense possibly damaging 0.88
R4927:Olfm1 UTSW 2 28214786 missense probably benign 0.18
R4940:Olfm1 UTSW 2 28222590 missense possibly damaging 0.51
R7033:Olfm1 UTSW 2 28229336 missense probably damaging 1.00
R7059:Olfm1 UTSW 2 28222616 missense probably damaging 1.00
X0018:Olfm1 UTSW 2 28229369 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GAGGTCAAAACTCTGAGCACCCAG -3'
(R):5'- GAAGCAGGTGTACTCATCTCCCAAC -3'

Sequencing Primer
(F):5'- ACCCAGGGTTGAACATGC -3'
(R):5'- TCATCTCCCAACCAGGGC -3'
Posted On2013-05-09