Incidental Mutation 'R0411:Bmpr1a'
ID36684
Institutional Source Beutler Lab
Gene Symbol Bmpr1a
Ensembl Gene ENSMUSG00000021796
Gene Namebone morphogenetic protein receptor, type 1A
SynonymsBMPR-IA, 1110037I22Rik, Bmpr, ALK3
MMRRC Submission 038613-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0411 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location34410734-34503341 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34415877 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 391 (T391I)
Ref Sequence ENSEMBL: ENSMUSP00000131984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049005] [ENSMUST00000165280]
Predicted Effect probably benign
Transcript: ENSMUST00000049005
AA Change: T391I

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000035900
Gene: ENSMUSG00000021796
AA Change: T391I

DomainStartEndE-ValueType
Pfam:Activin_recp 59 138 4.6e-14 PFAM
transmembrane domain 153 175 N/A INTRINSIC
GS 204 234 7.44e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165280
AA Change: T391I

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131984
Gene: ENSMUSG00000021796
AA Change: T391I

DomainStartEndE-ValueType
Pfam:Activin_recp 59 138 1.3e-14 PFAM
transmembrane domain 153 175 N/A INTRINSIC
GS 204 234 7.44e-13 SMART
Meta Mutation Damage Score 0.166 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The bone morphogenetic protein (BMP) receptors are a family of transmembrane serine/threonine kinases that include the type I receptors BMPR1A and BMPR1B and the type II receptor BMPR2. These receptors are also closely related to the activin receptors, ACVR1 and ACVR2. The ligands of these receptors are members of the TGF-beta superfamily. TGF-betas and activins transduce their signals through the formation of heteromeric complexes with 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die by embryonic day 9.5, are smaller than normal, and form no mesoderm; a conditional knockout resulted in gross malformations of the limbs with complete agenesis of the hindlimb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,896,491 probably benign Het
6030469F06Rik A T 12: 31,184,731 noncoding transcript Het
Acad11 T C 9: 104,116,296 F541L probably damaging Het
Acin1 G T 14: 54,646,774 R92S probably damaging Het
Appl1 A G 14: 26,940,256 S490P probably benign Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Arih1 A T 9: 59,485,983 I122N possibly damaging Het
Bmi1 T C 2: 18,683,172 probably benign Het
Cacna1s A G 1: 136,113,303 K1256E probably damaging Het
Cacng3 C T 7: 122,768,572 P225L probably damaging Het
Cd101 A T 3: 101,018,527 probably null Het
Cd55 A G 1: 130,462,557 probably benign Het
Cenpe T C 3: 135,222,255 I258T probably damaging Het
Cma2 A G 14: 55,973,678 probably benign Het
Ddost T A 4: 138,309,653 S176T probably benign Het
Ddx19b A T 8: 111,023,964 probably null Het
Dmxl2 A G 9: 54,378,939 I2681T probably damaging Het
Ern1 C T 11: 106,398,586 E964K probably benign Het
Galntl5 C T 5: 25,220,174 R430C probably benign Het
Gga3 A G 11: 115,587,433 L511P probably damaging Het
Gm7271 G T 5: 76,500,487 V47L possibly damaging Het
Gria2 C T 3: 80,710,858 probably benign Het
Hmbs A T 9: 44,341,652 L28* probably null Het
Iffo2 A G 4: 139,603,221 E220G probably damaging Het
Ifi30 A G 8: 70,764,918 probably benign Het
Irf2 T A 8: 46,846,061 C297S probably benign Het
Izumo4 T C 10: 80,703,084 Y94H probably damaging Het
Klhdc9 A G 1: 171,359,785 V215A probably benign Het
Kmt2a T C 9: 44,819,964 probably benign Het
Kmt2c A T 5: 25,375,957 C513S probably damaging Het
Lyg1 A T 1: 37,949,896 M81K possibly damaging Het
Maip1 T G 1: 57,415,693 W279G probably damaging Het
Myo7a T C 7: 98,071,937 T1263A probably benign Het
Naa15 T A 3: 51,465,639 I701N possibly damaging Het
Ncoa3 A G 2: 166,068,543 N1292S probably benign Het
Necab2 T A 8: 119,454,240 probably benign Het
Nfatc1 T A 18: 80,698,042 I234F possibly damaging Het
Olfm1 G A 2: 28,208,211 R95K possibly damaging Het
Olfr1118 A G 2: 87,309,058 T90A probably benign Het
Olfr1329 A T 4: 118,916,626 N280K possibly damaging Het
Otoa T C 7: 121,156,527 probably null Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pard6g A G 18: 80,117,122 D150G probably damaging Het
Pax5 A G 4: 44,609,783 L215S probably damaging Het
Pja2 A T 17: 64,287,521 probably benign Het
Plk4 T A 3: 40,811,219 probably benign Het
Polr1a A T 6: 71,978,421 H1687L possibly damaging Het
Ptcd2 G A 13: 99,343,391 L41F probably damaging Het
Ropn1 T A 16: 34,669,964 S62T probably benign Het
Setd1a T C 7: 127,796,051 probably benign Het
Setdb1 T C 3: 95,327,686 D902G probably damaging Het
Sik3 T A 9: 46,208,770 L719Q probably damaging Het
Slc36a1 G T 11: 55,232,507 V433F probably benign Het
Slc6a3 T C 13: 73,557,050 V220A possibly damaging Het
Slc6a5 A T 7: 49,911,791 R24W probably damaging Het
Smox G T 2: 131,520,644 R281L probably benign Het
Sulf2 G T 2: 166,093,516 H226N probably damaging Het
Syne2 C T 12: 76,059,584 probably null Het
Tenm3 C T 8: 48,287,791 S1210N possibly damaging Het
Tns1 A T 1: 73,925,761 V1237E probably damaging Het
Trf C T 9: 103,217,501 V92M probably damaging Het
Ttn A G 2: 76,709,373 V34423A possibly damaging Het
Vmn2r118 A G 17: 55,611,021 probably benign Het
Vmn2r19 A G 6: 123,309,744 Y112C probably damaging Het
Wdr66 C T 5: 123,290,054 T538M probably damaging Het
Zfp326 G T 5: 105,878,775 A15S possibly damaging Het
Other mutations in Bmpr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Bmpr1a APN 14 34434419 missense probably benign
IGL03100:Bmpr1a APN 14 34441207 unclassified probably benign
R0329:Bmpr1a UTSW 14 34429777 missense probably benign 0.03
R0330:Bmpr1a UTSW 14 34429777 missense probably benign 0.03
R0537:Bmpr1a UTSW 14 34443812 unclassified probably benign
R1707:Bmpr1a UTSW 14 34425141 splice site probably benign
R1767:Bmpr1a UTSW 14 34447770 critical splice donor site probably null
R1992:Bmpr1a UTSW 14 34425093 missense probably damaging 1.00
R3757:Bmpr1a UTSW 14 34434667 nonsense probably null
R4125:Bmpr1a UTSW 14 34434733 missense probably benign 0.35
R5320:Bmpr1a UTSW 14 34425042 missense probably damaging 1.00
R6956:Bmpr1a UTSW 14 34441175 missense possibly damaging 0.90
R7254:Bmpr1a UTSW 14 34414763 missense probably benign 0.03
R7267:Bmpr1a UTSW 14 34443879 missense possibly damaging 0.47
R7270:Bmpr1a UTSW 14 34441125 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAGAGTGGTCCTGAGAAACCCTG -3'
(R):5'- CTTCTTTGGTGACAGAGCCTCAGC -3'

Sequencing Primer
(F):5'- TGACCCAGGTGACACAAATTAG -3'
(R):5'- TCCAGTTTAGTGTGAAAAAGTTAGTG -3'
Posted On2013-05-09