Incidental Mutation 'R0411:Slc36a1'
ID36678
Institutional Source Beutler Lab
Gene Symbol Slc36a1
Ensembl Gene ENSMUSG00000020261
Gene Namesolute carrier family 36 (proton/amino acid symporter), member 1
Synonyms5830411H19Rik, Pat1
MMRRC Submission 038613-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R0411 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location55204350-55236330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55232507 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 433 (V433F)
Ref Sequence ENSEMBL: ENSMUSP00000104500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020499] [ENSMUST00000108867] [ENSMUST00000108872]
Predicted Effect probably benign
Transcript: ENSMUST00000020499
AA Change: V433F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000020499
Gene: ENSMUSG00000020261
AA Change: V433F

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
Pfam:Aa_trans 44 456 5e-77 PFAM
low complexity region 462 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108867
AA Change: V433F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000104495
Gene: ENSMUSG00000020261
AA Change: V433F

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
Pfam:Aa_trans 44 456 5e-77 PFAM
low complexity region 462 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108872
AA Change: V433F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000104500
Gene: ENSMUSG00000020261
AA Change: V433F

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
Pfam:Aa_trans 44 456 1.6e-77 PFAM
low complexity region 462 472 N/A INTRINSIC
Meta Mutation Damage Score 0.1528 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eukaryote-specific amino acid/auxin permease (AAAP) 1 transporter family. The encoded protein functions as a proton-dependent, small amino acid transporter. This gene is clustered with related family members on chromosome 5q33.1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,896,491 probably benign Het
6030469F06Rik A T 12: 31,184,731 noncoding transcript Het
Acad11 T C 9: 104,116,296 F541L probably damaging Het
Acin1 G T 14: 54,646,774 R92S probably damaging Het
Appl1 A G 14: 26,940,256 S490P probably benign Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Arih1 A T 9: 59,485,983 I122N possibly damaging Het
Bmi1 T C 2: 18,683,172 probably benign Het
Bmpr1a G A 14: 34,415,877 T391I possibly damaging Het
Cacna1s A G 1: 136,113,303 K1256E probably damaging Het
Cacng3 C T 7: 122,768,572 P225L probably damaging Het
Cd101 A T 3: 101,018,527 probably null Het
Cd55 A G 1: 130,462,557 probably benign Het
Cenpe T C 3: 135,222,255 I258T probably damaging Het
Cma2 A G 14: 55,973,678 probably benign Het
Ddost T A 4: 138,309,653 S176T probably benign Het
Ddx19b A T 8: 111,023,964 probably null Het
Dmxl2 A G 9: 54,378,939 I2681T probably damaging Het
Ern1 C T 11: 106,398,586 E964K probably benign Het
Galntl5 C T 5: 25,220,174 R430C probably benign Het
Gga3 A G 11: 115,587,433 L511P probably damaging Het
Gm7271 G T 5: 76,500,487 V47L possibly damaging Het
Gria2 C T 3: 80,710,858 probably benign Het
Hmbs A T 9: 44,341,652 L28* probably null Het
Iffo2 A G 4: 139,603,221 E220G probably damaging Het
Ifi30 A G 8: 70,764,918 probably benign Het
Irf2 T A 8: 46,846,061 C297S probably benign Het
Izumo4 T C 10: 80,703,084 Y94H probably damaging Het
Klhdc9 A G 1: 171,359,785 V215A probably benign Het
Kmt2a T C 9: 44,819,964 probably benign Het
Kmt2c A T 5: 25,375,957 C513S probably damaging Het
Lyg1 A T 1: 37,949,896 M81K possibly damaging Het
Maip1 T G 1: 57,415,693 W279G probably damaging Het
Myo7a T C 7: 98,071,937 T1263A probably benign Het
Naa15 T A 3: 51,465,639 I701N possibly damaging Het
Ncoa3 A G 2: 166,068,543 N1292S probably benign Het
Necab2 T A 8: 119,454,240 probably benign Het
Nfatc1 T A 18: 80,698,042 I234F possibly damaging Het
Olfm1 G A 2: 28,208,211 R95K possibly damaging Het
Olfr1118 A G 2: 87,309,058 T90A probably benign Het
Olfr1329 A T 4: 118,916,626 N280K possibly damaging Het
Otoa T C 7: 121,156,527 probably null Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pard6g A G 18: 80,117,122 D150G probably damaging Het
Pax5 A G 4: 44,609,783 L215S probably damaging Het
Pja2 A T 17: 64,287,521 probably benign Het
Plk4 T A 3: 40,811,219 probably benign Het
Polr1a A T 6: 71,978,421 H1687L possibly damaging Het
Ptcd2 G A 13: 99,343,391 L41F probably damaging Het
Ropn1 T A 16: 34,669,964 S62T probably benign Het
Setd1a T C 7: 127,796,051 probably benign Het
Setdb1 T C 3: 95,327,686 D902G probably damaging Het
Sik3 T A 9: 46,208,770 L719Q probably damaging Het
Slc6a3 T C 13: 73,557,050 V220A possibly damaging Het
Slc6a5 A T 7: 49,911,791 R24W probably damaging Het
Smox G T 2: 131,520,644 R281L probably benign Het
Sulf2 G T 2: 166,093,516 H226N probably damaging Het
Syne2 C T 12: 76,059,584 probably null Het
Tenm3 C T 8: 48,287,791 S1210N possibly damaging Het
Tns1 A T 1: 73,925,761 V1237E probably damaging Het
Trf C T 9: 103,217,501 V92M probably damaging Het
Ttn A G 2: 76,709,373 V34423A possibly damaging Het
Vmn2r118 A G 17: 55,611,021 probably benign Het
Vmn2r19 A G 6: 123,309,744 Y112C probably damaging Het
Wdr66 C T 5: 123,290,054 T538M probably damaging Het
Zfp326 G T 5: 105,878,775 A15S possibly damaging Het
Other mutations in Slc36a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Slc36a1 APN 11 55226128 missense probably damaging 1.00
IGL01520:Slc36a1 APN 11 55219656 missense probably benign 0.11
IGL01653:Slc36a1 APN 11 55228321 missense possibly damaging 0.73
IGL02801:Slc36a1 APN 11 55226053 missense probably benign 0.04
IGL03093:Slc36a1 APN 11 55219604 missense probably benign 0.09
IGL03183:Slc36a1 APN 11 55228191 missense probably damaging 1.00
PIT4466001:Slc36a1 UTSW 11 55219069 missense probably damaging 1.00
R0058:Slc36a1 UTSW 11 55221994 splice site probably benign
R0058:Slc36a1 UTSW 11 55221994 splice site probably benign
R0288:Slc36a1 UTSW 11 55219087 missense probably damaging 1.00
R0964:Slc36a1 UTSW 11 55225954 unclassified probably benign
R1730:Slc36a1 UTSW 11 55223672 missense probably damaging 1.00
R1748:Slc36a1 UTSW 11 55228324 missense probably damaging 1.00
R1783:Slc36a1 UTSW 11 55223672 missense probably damaging 1.00
R1826:Slc36a1 UTSW 11 55220453 missense probably benign 0.01
R2029:Slc36a1 UTSW 11 55228338 missense probably benign 0.37
R2927:Slc36a1 UTSW 11 55232375 missense probably damaging 1.00
R4541:Slc36a1 UTSW 11 55222023 missense probably benign 0.35
R7033:Slc36a1 UTSW 11 55223737 missense probably benign 0.05
R7059:Slc36a1 UTSW 11 55223672 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCATATCTCCTACAGCCCCAG -3'
(R):5'- TCCAATGCCAGATAGAGCAGTGCC -3'

Sequencing Primer
(F):5'- GGCACTCTTGAACAAAGACG -3'
(R):5'- TTCCAGAGGCTGGACTATACCTG -3'
Posted On2013-05-09