Incidental Mutation 'R0411:Hmbs'
ID36669
Institutional Source Beutler Lab
Gene Symbol Hmbs
Ensembl Gene ENSMUSG00000032126
Gene Namehydroxymethylbilane synthase
Synonymsporphobilinogen deaminase, PBGD, Uros1, Ups
MMRRC Submission 038613-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0411 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44336339-44344228 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 44341652 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 28 (L28*)
Ref Sequence ENSEMBL: ENSMUSP00000149522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077353] [ENSMUST00000097558] [ENSMUST00000215091] [ENSMUST00000216852]
Predicted Effect probably null
Transcript: ENSMUST00000077353
AA Change: L45*
SMART Domains Protein: ENSMUSP00000076575
Gene: ENSMUSG00000032126
AA Change: L45*

DomainStartEndE-ValueType
Pfam:Porphobil_deam 21 233 1.7e-79 PFAM
Pfam:Porphobil_deamC 244 323 6.8e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000097558
AA Change: L28*
SMART Domains Protein: ENSMUSP00000095166
Gene: ENSMUSG00000032126
AA Change: L28*

DomainStartEndE-ValueType
Pfam:Porphobil_deam 3 219 3.9e-95 PFAM
Pfam:Porphobil_deamC 227 327 4.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214967
Predicted Effect probably null
Transcript: ENSMUST00000215091
AA Change: L28*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215934
Predicted Effect probably benign
Transcript: ENSMUST00000216658
Predicted Effect probably benign
Transcript: ENSMUST00000216852
Meta Mutation Damage Score 0.59 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for one null allele and a functional allele with a milder mutation exhibit typical features of acute intermittent porphyria with massive urinary excretion of aminolevulinic acid after phenobarbital treatment, erythruria, ataxia, motor dysfunction, and neurologic muscle atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,896,491 probably benign Het
6030469F06Rik A T 12: 31,184,731 noncoding transcript Het
Acad11 T C 9: 104,116,296 F541L probably damaging Het
Acin1 G T 14: 54,646,774 R92S probably damaging Het
Appl1 A G 14: 26,940,256 S490P probably benign Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Arih1 A T 9: 59,485,983 I122N possibly damaging Het
Bmi1 T C 2: 18,683,172 probably benign Het
Bmpr1a G A 14: 34,415,877 T391I possibly damaging Het
Cacna1s A G 1: 136,113,303 K1256E probably damaging Het
Cacng3 C T 7: 122,768,572 P225L probably damaging Het
Cd101 A T 3: 101,018,527 probably null Het
Cd55 A G 1: 130,462,557 probably benign Het
Cenpe T C 3: 135,222,255 I258T probably damaging Het
Cma2 A G 14: 55,973,678 probably benign Het
Ddost T A 4: 138,309,653 S176T probably benign Het
Ddx19b A T 8: 111,023,964 probably null Het
Dmxl2 A G 9: 54,378,939 I2681T probably damaging Het
Ern1 C T 11: 106,398,586 E964K probably benign Het
Galntl5 C T 5: 25,220,174 R430C probably benign Het
Gga3 A G 11: 115,587,433 L511P probably damaging Het
Gm7271 G T 5: 76,500,487 V47L possibly damaging Het
Gria2 C T 3: 80,710,858 probably benign Het
Iffo2 A G 4: 139,603,221 E220G probably damaging Het
Ifi30 A G 8: 70,764,918 probably benign Het
Irf2 T A 8: 46,846,061 C297S probably benign Het
Izumo4 T C 10: 80,703,084 Y94H probably damaging Het
Klhdc9 A G 1: 171,359,785 V215A probably benign Het
Kmt2a T C 9: 44,819,964 probably benign Het
Kmt2c A T 5: 25,375,957 C513S probably damaging Het
Lyg1 A T 1: 37,949,896 M81K possibly damaging Het
Maip1 T G 1: 57,415,693 W279G probably damaging Het
Myo7a T C 7: 98,071,937 T1263A probably benign Het
Naa15 T A 3: 51,465,639 I701N possibly damaging Het
Ncoa3 A G 2: 166,068,543 N1292S probably benign Het
Necab2 T A 8: 119,454,240 probably benign Het
Nfatc1 T A 18: 80,698,042 I234F possibly damaging Het
Olfm1 G A 2: 28,208,211 R95K possibly damaging Het
Olfr1118 A G 2: 87,309,058 T90A probably benign Het
Olfr1329 A T 4: 118,916,626 N280K possibly damaging Het
Otoa T C 7: 121,156,527 probably null Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pard6g A G 18: 80,117,122 D150G probably damaging Het
Pax5 A G 4: 44,609,783 L215S probably damaging Het
Pja2 A T 17: 64,287,521 probably benign Het
Plk4 T A 3: 40,811,219 probably benign Het
Polr1a A T 6: 71,978,421 H1687L possibly damaging Het
Ptcd2 G A 13: 99,343,391 L41F probably damaging Het
Ropn1 T A 16: 34,669,964 S62T probably benign Het
Setd1a T C 7: 127,796,051 probably benign Het
Setdb1 T C 3: 95,327,686 D902G probably damaging Het
Sik3 T A 9: 46,208,770 L719Q probably damaging Het
Slc36a1 G T 11: 55,232,507 V433F probably benign Het
Slc6a3 T C 13: 73,557,050 V220A possibly damaging Het
Slc6a5 A T 7: 49,911,791 R24W probably damaging Het
Smox G T 2: 131,520,644 R281L probably benign Het
Sulf2 G T 2: 166,093,516 H226N probably damaging Het
Syne2 C T 12: 76,059,584 probably null Het
Tenm3 C T 8: 48,287,791 S1210N possibly damaging Het
Tns1 A T 1: 73,925,761 V1237E probably damaging Het
Trf C T 9: 103,217,501 V92M probably damaging Het
Ttn A G 2: 76,709,373 V34423A possibly damaging Het
Vmn2r118 A G 17: 55,611,021 probably benign Het
Vmn2r19 A G 6: 123,309,744 Y112C probably damaging Het
Wdr66 C T 5: 123,290,054 T538M probably damaging Het
Zfp326 G T 5: 105,878,775 A15S possibly damaging Het
Other mutations in Hmbs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01526:Hmbs APN 9 44339548 missense possibly damaging 0.91
IGL02312:Hmbs APN 9 44341213 critical splice donor site probably null
R0386:Hmbs UTSW 9 44337008 missense probably benign 0.06
R0656:Hmbs UTSW 9 44337360 missense probably benign 0.31
R1503:Hmbs UTSW 9 44337432 missense probably benign 0.42
R1560:Hmbs UTSW 9 44337360 missense possibly damaging 0.71
R1953:Hmbs UTSW 9 44337444 missense probably damaging 1.00
R2127:Hmbs UTSW 9 44340707 missense probably benign 0.09
R4637:Hmbs UTSW 9 44339537 missense probably damaging 1.00
R5549:Hmbs UTSW 9 44339477 critical splice donor site probably null
R6611:Hmbs UTSW 9 44341691 missense probably damaging 0.98
X0024:Hmbs UTSW 9 44337968 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTCCCTTCACAAGCAGCCAGAATAG -3'
(R):5'- CGGCTCAAAGATGAGGGTGATTCG -3'

Sequencing Primer
(F):5'- TAGTCTTACAAGGCAGGCTTTGAC -3'
(R):5'- TGTAATGCTCACAGGGTCAC -3'
Posted On2013-05-09