Incidental Mutation 'R0411:Cd55'
ID177845
Institutional Source Beutler Lab
Gene Symbol Cd55
Ensembl Gene ENSMUSG00000026399
Gene NameCD55 molecule, decay accelerating factor for complement
Synonymscomplement-glycosylphosphatidylinositol, Daf1, Cromer blood group, GPI-DAF, Daf-GPI
MMRRC Submission 038613-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0411 (G1)
Quality Score59
Status Validated
Chromosome1
Chromosomal Location130439027-130462744 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 130462557 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027650]
Predicted Effect probably benign
Transcript: ENSMUST00000027650
SMART Domains Protein: ENSMUSP00000027650
Gene: ENSMUSG00000026399

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
CCP 36 94 2.21e-12 SMART
CCP 98 158 3.56e-7 SMART
CCP 163 220 6.34e-13 SMART
CCP 225 284 1.28e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140725
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (66/68)
MGI Phenotype FUNCTION: This gene encodes an inhibitor of both the classical and the alternative pathways of complement activation. The encoded preproprotein undergoes post-translational processing to generate a mature polypeptide anchored to the plasma membrane via a glycosylphosphatidylinositol moiety. Erythrocytes from mice deficient in the encoded protein exhibit impaired regulation of complement activation resulting in enhanced complement deposition. Mice lacking the encoded protein exhibit enhanced susceptibility to experimentally induced myasthenia gravis. This gene is located adjacent to a closely related gene on chromosome 1. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutant mice show increased susceptibility to injury following ethanol exposure, to experimental autoimmune myasthenia gravis and to acute nephrotoxic nephritis. Another allele results in an abnormal complement cascade leading to increased C3 deposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik A G 5: 63,896,491 probably benign Het
6030469F06Rik A T 12: 31,184,731 noncoding transcript Het
Acad11 T C 9: 104,116,296 F541L probably damaging Het
Acin1 G T 14: 54,646,774 R92S probably damaging Het
Appl1 A G 14: 26,940,256 S490P probably benign Het
Aqp9 C A 9: 71,130,444 V184L probably benign Het
Arih1 A T 9: 59,485,983 I122N possibly damaging Het
Bmi1 T C 2: 18,683,172 probably benign Het
Bmpr1a G A 14: 34,415,877 T391I possibly damaging Het
Cacna1s A G 1: 136,113,303 K1256E probably damaging Het
Cacng3 C T 7: 122,768,572 P225L probably damaging Het
Cd101 A T 3: 101,018,527 probably null Het
Cenpe T C 3: 135,222,255 I258T probably damaging Het
Cma2 A G 14: 55,973,678 probably benign Het
Ddost T A 4: 138,309,653 S176T probably benign Het
Ddx19b A T 8: 111,023,964 probably null Het
Dmxl2 A G 9: 54,378,939 I2681T probably damaging Het
Ern1 C T 11: 106,398,586 E964K probably benign Het
Galntl5 C T 5: 25,220,174 R430C probably benign Het
Gga3 A G 11: 115,587,433 L511P probably damaging Het
Gm7271 G T 5: 76,500,487 V47L possibly damaging Het
Gria2 C T 3: 80,710,858 probably benign Het
Hmbs A T 9: 44,341,652 L28* probably null Het
Iffo2 A G 4: 139,603,221 E220G probably damaging Het
Ifi30 A G 8: 70,764,918 probably benign Het
Irf2 T A 8: 46,846,061 C297S probably benign Het
Izumo4 T C 10: 80,703,084 Y94H probably damaging Het
Klhdc9 A G 1: 171,359,785 V215A probably benign Het
Kmt2a T C 9: 44,819,964 probably benign Het
Kmt2c A T 5: 25,375,957 C513S probably damaging Het
Lyg1 A T 1: 37,949,896 M81K possibly damaging Het
Maip1 T G 1: 57,415,693 W279G probably damaging Het
Myo7a T C 7: 98,071,937 T1263A probably benign Het
Naa15 T A 3: 51,465,639 I701N possibly damaging Het
Ncoa3 A G 2: 166,068,543 N1292S probably benign Het
Necab2 T A 8: 119,454,240 probably benign Het
Nfatc1 T A 18: 80,698,042 I234F possibly damaging Het
Olfm1 G A 2: 28,208,211 R95K possibly damaging Het
Olfr1118 A G 2: 87,309,058 T90A probably benign Het
Olfr1329 A T 4: 118,916,626 N280K possibly damaging Het
Otoa T C 7: 121,156,527 probably null Het
Padi4 GCTGCGTACCTCCAC GC 4: 140,748,449 probably benign Het
Pard6g A G 18: 80,117,122 D150G probably damaging Het
Pax5 A G 4: 44,609,783 L215S probably damaging Het
Pja2 A T 17: 64,287,521 probably benign Het
Plk4 T A 3: 40,811,219 probably benign Het
Polr1a A T 6: 71,978,421 H1687L possibly damaging Het
Ptcd2 G A 13: 99,343,391 L41F probably damaging Het
Ropn1 T A 16: 34,669,964 S62T probably benign Het
Setd1a T C 7: 127,796,051 probably benign Het
Setdb1 T C 3: 95,327,686 D902G probably damaging Het
Sik3 T A 9: 46,208,770 L719Q probably damaging Het
Slc36a1 G T 11: 55,232,507 V433F probably benign Het
Slc6a3 T C 13: 73,557,050 V220A possibly damaging Het
Slc6a5 A T 7: 49,911,791 R24W probably damaging Het
Smox G T 2: 131,520,644 R281L probably benign Het
Sulf2 G T 2: 166,093,516 H226N probably damaging Het
Syne2 C T 12: 76,059,584 probably null Het
Tenm3 C T 8: 48,287,791 S1210N possibly damaging Het
Tns1 A T 1: 73,925,761 V1237E probably damaging Het
Trf C T 9: 103,217,501 V92M probably damaging Het
Ttn A G 2: 76,709,373 V34423A possibly damaging Het
Vmn2r118 A G 17: 55,611,021 probably benign Het
Vmn2r19 A G 6: 123,309,744 Y112C probably damaging Het
Wdr66 C T 5: 123,290,054 T538M probably damaging Het
Zfp326 G T 5: 105,878,775 A15S possibly damaging Het
Other mutations in Cd55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Cd55 APN 1 130452511 nonsense probably null
IGL02207:Cd55 APN 1 130452419 missense possibly damaging 0.46
IGL02724:Cd55 APN 1 130449412 splice site probably benign
IGL02933:Cd55 APN 1 130452524 missense probably damaging 1.00
IGL02955:Cd55 APN 1 130449482 missense probably damaging 0.98
IGL03198:Cd55 APN 1 130440371 missense probably benign 0.03
PIT4618001:Cd55 UTSW 1 130456869 missense probably benign
R0055:Cd55 UTSW 1 130459576 splice site probably benign
R0426:Cd55 UTSW 1 130448372 missense probably benign 0.07
R1488:Cd55 UTSW 1 130448378 missense probably damaging 0.98
R1728:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1728:Cd55 UTSW 1 130459633 missense probably benign
R1729:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1729:Cd55 UTSW 1 130459633 missense probably benign
R1730:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1730:Cd55 UTSW 1 130459633 missense probably benign
R1739:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1739:Cd55 UTSW 1 130459633 missense probably benign
R1762:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1762:Cd55 UTSW 1 130459633 missense probably benign
R1783:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1783:Cd55 UTSW 1 130459633 missense probably benign
R1784:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1784:Cd55 UTSW 1 130459633 missense probably benign
R1785:Cd55 UTSW 1 130449423 missense probably benign 0.32
R1785:Cd55 UTSW 1 130459633 missense probably benign
R1835:Cd55 UTSW 1 130447609 splice site probably benign
R2049:Cd55 UTSW 1 130449423 missense probably benign 0.32
R2122:Cd55 UTSW 1 130459617 missense possibly damaging 0.94
R2141:Cd55 UTSW 1 130449423 missense probably benign 0.32
R2142:Cd55 UTSW 1 130449423 missense probably benign 0.32
R2935:Cd55 UTSW 1 130452426 missense possibly damaging 0.65
R4326:Cd55 UTSW 1 130452483 missense probably damaging 1.00
R4328:Cd55 UTSW 1 130447367 intron probably benign
R4328:Cd55 UTSW 1 130452483 missense probably damaging 1.00
R4329:Cd55 UTSW 1 130452483 missense probably damaging 1.00
R5051:Cd55 UTSW 1 130448348 missense probably damaging 0.99
R6467:Cd55 UTSW 1 130447611 splice site probably benign
R7219:Cd55 UTSW 1 130462606 missense possibly damaging 0.73
Z1088:Cd55 UTSW 1 130452479 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTCAGGAACTTGGAATGCTTGGAC -3'
(R):5'- TGCTCAATTAACTGCGGCTCAAAAC -3'

Sequencing Primer
(F):5'- AATGCTTGGACTCTCGTGAAC -3'
(R):5'- TGCGGCTCAAAACAGCTC -3'
Posted On2014-04-29