Incidental Mutation 'R3161:Ciz1'
ID258147
Institutional Source Beutler Lab
Gene Symbol Ciz1
Ensembl Gene ENSMUSG00000039205
Gene NameCDKN1A interacting zinc finger protein 1
Synonyms0610038H21Rik, 2900056O04Rik
MMRRC Submission 040612-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R3161 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32352327-32380970 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32370063 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 207 (D207G)
Ref Sequence ENSEMBL: ENSMUSP00000116812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048964] [ENSMUST00000113331] [ENSMUST00000113332] [ENSMUST00000113334] [ENSMUST00000113338] [ENSMUST00000131152] [ENSMUST00000132028] [ENSMUST00000136079]
Predicted Effect probably benign
Transcript: ENSMUST00000048964
AA Change: D207G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000048428
Gene: ENSMUSG00000039205
AA Change: D207G

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113331
AA Change: D183G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000108957
Gene: ENSMUSG00000039205
AA Change: D183G

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 104 116 N/A INTRINSIC
low complexity region 221 232 N/A INTRINSIC
internal_repeat_2 252 284 9.48e-5 PROSPERO
internal_repeat_2 301 333 9.48e-5 PROSPERO
low complexity region 337 366 N/A INTRINSIC
ZnF_U1 510 544 1.23e-1 SMART
ZnF_C2H2 513 537 1.99e0 SMART
ZnF_U1 602 636 2.08e-1 SMART
ZnF_C2H2 605 629 3.02e0 SMART
low complexity region 665 685 N/A INTRINSIC
ZnF_U1 720 755 1.43e-4 SMART
ZnF_C2H2 723 748 9.56e1 SMART
low complexity region 799 821 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113332
AA Change: D202G

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108958
Gene: ENSMUSG00000039205
AA Change: D202G

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
ZnF_U1 480 514 1.23e-1 SMART
ZnF_C2H2 483 507 1.99e0 SMART
Blast:ZnF_U1 543 570 2e-6 BLAST
ZnF_U1 572 606 2.08e-1 SMART
ZnF_C2H2 575 599 3.02e0 SMART
low complexity region 635 655 N/A INTRINSIC
ZnF_U1 690 725 1.43e-4 SMART
ZnF_C2H2 693 718 9.56e1 SMART
low complexity region 769 791 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113334
AA Change: D207G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000108960
Gene: ENSMUSG00000039205
AA Change: D207G

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113338
AA Change: D207G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000108964
Gene: ENSMUSG00000039205
AA Change: D207G

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 245 256 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
ZnF_U1 534 568 1.23e-1 SMART
ZnF_C2H2 537 561 1.99e0 SMART
ZnF_U1 626 660 2.08e-1 SMART
ZnF_C2H2 629 653 3.02e0 SMART
low complexity region 689 709 N/A INTRINSIC
ZnF_U1 744 779 1.43e-4 SMART
ZnF_C2H2 747 772 9.56e1 SMART
low complexity region 823 845 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125482
SMART Domains Protein: ENSMUSP00000120019
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
ZnF_C2H2 216 240 1.99e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125769
Predicted Effect probably benign
Transcript: ENSMUST00000131152
SMART Domains Protein: ENSMUSP00000141211
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132028
SMART Domains Protein: ENSMUSP00000120295
Gene: ENSMUSG00000039205

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134141
Predicted Effect probably benign
Transcript: ENSMUST00000136079
AA Change: D207G

PolyPhen 2 Score 0.110 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000116812
Gene: ENSMUSG00000039205
AA Change: D207G

DomainStartEndE-ValueType
coiled coil region 5 45 N/A INTRINSIC
low complexity region 58 80 N/A INTRINSIC
low complexity region 85 99 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137220
Predicted Effect unknown
Transcript: ENSMUST00000139637
AA Change: D46G
SMART Domains Protein: ENSMUSP00000122469
Gene: ENSMUSG00000039205
AA Change: D46G

DomainStartEndE-ValueType
low complexity region 85 96 N/A INTRINSIC
low complexity region 201 230 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145957
Predicted Effect unknown
Transcript: ENSMUST00000151806
AA Change: D31G
SMART Domains Protein: ENSMUSP00000119429
Gene: ENSMUSG00000039205
AA Change: D31G

DomainStartEndE-ValueType
low complexity region 70 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192758
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger DNA binding protein that interacts with CIP1, part of a complex with cyclin E. The encoded protein may regulate the cellular localization of CIP1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice hoomozygous for a knock-out allele exhibit decreased body size and gender specific effects on motor phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700066M21Rik T A 1: 57,383,075 N203K probably benign Het
1700125H20Rik A G 11: 85,173,284 S84G probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgrl2 G A 3: 148,817,551 L1354F probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Aox2 G T 1: 58,304,438 V427L possibly damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
Bptf A T 11: 107,074,476 D1182E probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crabp2 A T 3: 87,952,177 K45* probably null Het
Daam1 C A 12: 71,947,098 T425K unknown Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dlg4 G C 11: 70,017,225 R4T probably damaging Het
Fbf1 A G 11: 116,148,220 I743T probably damaging Het
Fen1 A G 19: 10,200,291 L263P probably damaging Het
G6pc2 A G 2: 69,220,112 N27S probably damaging Het
Garnl3 A T 2: 33,034,711 N246K probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Gpr152 A G 19: 4,142,714 T85A probably benign Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Ighv1-81 C G 12: 115,920,329 E101Q probably benign Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Myo9a C T 9: 59,832,315 probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr213 C T 6: 116,540,846 A131V probably damaging Het
Olfr262 T C 19: 12,241,496 H55R probably benign Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Phyh T A 2: 4,937,671 probably benign Het
Pkp4 G T 2: 59,308,105 R233M probably damaging Het
Plcb1 A T 2: 135,335,482 Q578L probably benign Het
Ppil3 A T 1: 58,434,414 N92K probably benign Het
Prokr1 C T 6: 87,588,431 R144H probably damaging Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Sult2a4 T C 7: 13,989,471 T40A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Ttn A G 2: 76,833,237 probably benign Het
Vmn2r115 T A 17: 23,357,024 M532K possibly damaging Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wipf1 C T 2: 73,434,949 E437K probably damaging Het
Wls G T 3: 159,897,436 C162F probably damaging Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zfp868 A G 8: 69,612,085 S200P probably benign Het
Other mutations in Ciz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Ciz1 APN 2 32372388 missense probably damaging 1.00
IGL01872:Ciz1 APN 2 32378109 utr 3 prime probably benign
R0029:Ciz1 UTSW 2 32371419 splice site probably benign
R0122:Ciz1 UTSW 2 32371419 splice site probably benign
R0363:Ciz1 UTSW 2 32377363 critical splice donor site probably null
R0373:Ciz1 UTSW 2 32367467 missense probably damaging 1.00
R0653:Ciz1 UTSW 2 32372406 missense probably damaging 1.00
R0816:Ciz1 UTSW 2 32376376 unclassified probably benign
R1255:Ciz1 UTSW 2 32365876 critical splice donor site probably null
R2116:Ciz1 UTSW 2 32367465 missense probably damaging 0.99
R3732:Ciz1 UTSW 2 32367483 missense possibly damaging 0.68
R4014:Ciz1 UTSW 2 32374344 missense probably damaging 0.96
R4386:Ciz1 UTSW 2 32370099 missense possibly damaging 0.92
R4687:Ciz1 UTSW 2 32367465 missense probably damaging 0.99
R4786:Ciz1 UTSW 2 32377527 missense probably damaging 1.00
R4825:Ciz1 UTSW 2 32371741 missense probably damaging 0.99
R4869:Ciz1 UTSW 2 32364235 missense probably damaging 0.99
R4871:Ciz1 UTSW 2 32372288 splice site probably benign
R5270:Ciz1 UTSW 2 32374499 unclassified probably null
R5429:Ciz1 UTSW 2 32376043 missense possibly damaging 0.93
R5621:Ciz1 UTSW 2 32371741 missense probably damaging 0.96
R5721:Ciz1 UTSW 2 32376040 missense probably damaging 1.00
R5805:Ciz1 UTSW 2 32367396 missense probably damaging 1.00
R5960:Ciz1 UTSW 2 32371216 missense possibly damaging 0.85
R6187:Ciz1 UTSW 2 32370051 missense possibly damaging 0.90
R6612:Ciz1 UTSW 2 32377311 missense possibly damaging 0.93
R7006:Ciz1 UTSW 2 32371115 critical splice donor site probably null
R7200:Ciz1 UTSW 2 32364287 missense probably damaging 1.00
X0018:Ciz1 UTSW 2 32371252 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCAGAGGGTTACAGCATTAC -3'
(R):5'- AGCATGCTATCTGGACCGAC -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCGGGAG -3'
(R):5'- GCTATCTGGACCGACTAGTGAATC -3'
Posted On2015-01-23