Incidental Mutation 'R3161:G6pc2'
ID258150
Institutional Source Beutler Lab
Gene Symbol G6pc2
Ensembl Gene ENSMUSG00000005232
Gene Nameglucose-6-phosphatase, catalytic, 2
SynonymsIGRP, G6pc-rs, islet specific glucose-6-phosphatase
MMRRC Submission 040612-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R3161 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69211073-69227841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69220112 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 27 (N27S)
Ref Sequence ENSEMBL: ENSMUSP00000107936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005364] [ENSMUST00000112317]
Predicted Effect probably damaging
Transcript: ENSMUST00000005364
AA Change: N27S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005364
Gene: ENSMUSG00000005232
AA Change: N27S

DomainStartEndE-ValueType
acidPPc 53 194 7.83e-21 SMART
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 254 273 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112317
AA Change: N27S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107936
Gene: ENSMUSG00000005232
AA Change: N27S

DomainStartEndE-ValueType
SCOP:d1d2ta_ 6 126 5e-13 SMART
Blast:acidPPc 53 147 1e-65 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151953
Meta Mutation Damage Score 0.0784 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This gene encodes an enzyme that belongs to the glucose-6-phosphatase catalytic subunit family. Members of this family catalyze the hydrolysis of glucose-6-phosphate, the terminal step in gluconeogenic and glycogenolytic pathways, to release glucose into the bloodstream. The family member encoded by this gene is found specifically in pancreatic islets but has not been shown to have phosphotransferase or phosphatase activity exhibited by a similar liver enzyme. The non-obese diabetic (NOD) mouse is a model for human type 1 diabetes, an autoimmune disease in which T lymphocytes attack and destroy insulin-producing pancreatic beta cells. In NOD mice, the protein encoded by this gene is a major target of cell-mediated autoimmunity. Variations in the human and mouse genes are associated with lower fasting plasma glucose levels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a disruption of this gene show a significant drop in fasting blood glucose. Females also show a significant drop in plasma triacylglycerol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700066M21Rik T A 1: 57,383,075 N203K probably benign Het
1700125H20Rik A G 11: 85,173,284 S84G probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgrl2 G A 3: 148,817,551 L1354F probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Aox2 G T 1: 58,304,438 V427L possibly damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
Bptf A T 11: 107,074,476 D1182E probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Ciz1 A G 2: 32,370,063 D207G probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crabp2 A T 3: 87,952,177 K45* probably null Het
Daam1 C A 12: 71,947,098 T425K unknown Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dlg4 G C 11: 70,017,225 R4T probably damaging Het
Fbf1 A G 11: 116,148,220 I743T probably damaging Het
Fen1 A G 19: 10,200,291 L263P probably damaging Het
Garnl3 A T 2: 33,034,711 N246K probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Gpr152 A G 19: 4,142,714 T85A probably benign Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Ighv1-81 C G 12: 115,920,329 E101Q probably benign Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Myo9a C T 9: 59,832,315 probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr213 C T 6: 116,540,846 A131V probably damaging Het
Olfr262 T C 19: 12,241,496 H55R probably benign Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Phyh T A 2: 4,937,671 probably benign Het
Pkp4 G T 2: 59,308,105 R233M probably damaging Het
Plcb1 A T 2: 135,335,482 Q578L probably benign Het
Ppil3 A T 1: 58,434,414 N92K probably benign Het
Prokr1 C T 6: 87,588,431 R144H probably damaging Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Sult2a4 T C 7: 13,989,471 T40A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Ttn A G 2: 76,833,237 probably benign Het
Vmn2r115 T A 17: 23,357,024 M532K possibly damaging Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wipf1 C T 2: 73,434,949 E437K probably damaging Het
Wls G T 3: 159,897,436 C162F probably damaging Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zfp868 A G 8: 69,612,085 S200P probably benign Het
Other mutations in G6pc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:G6pc2 APN 2 69222967 missense probably damaging 1.00
IGL02031:G6pc2 APN 2 69222991 missense probably benign 0.36
IGL02504:G6pc2 APN 2 69226595 missense probably damaging 0.99
IGL02674:G6pc2 APN 2 69226566 critical splice acceptor site probably null
IGL03339:G6pc2 APN 2 69220895 splice site probably benign
R0011:G6pc2 UTSW 2 69226565 splice site probably benign
R1113:G6pc2 UTSW 2 69220226 missense probably damaging 1.00
R1308:G6pc2 UTSW 2 69220226 missense probably damaging 1.00
R1417:G6pc2 UTSW 2 69222968 missense probably damaging 1.00
R1441:G6pc2 UTSW 2 69220854 missense probably damaging 0.97
R1658:G6pc2 UTSW 2 69227069 missense probably damaging 1.00
R1762:G6pc2 UTSW 2 69220842 missense possibly damaging 0.53
R1768:G6pc2 UTSW 2 69222977 missense probably damaging 1.00
R5487:G6pc2 UTSW 2 69226577 missense probably damaging 0.99
R5623:G6pc2 UTSW 2 69226583 missense probably damaging 1.00
R5686:G6pc2 UTSW 2 69220784 missense probably benign 0.03
X0040:G6pc2 UTSW 2 69223010 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- ATGGCTCAGTGCATCACAAG -3'
(R):5'- TGTGTCGAAGTACATGCACCTG -3'

Sequencing Primer
(F):5'- GCTCAGTGCATCACAAGGGTAC -3'
(R):5'- GTACATGCACCTGAAACGTG -3'
Posted On2015-01-23