Incidental Mutation 'R3161:1700125H20Rik'
ID258175
Institutional Source Beutler Lab
Gene Symbol 1700125H20Rik
Ensembl Gene ENSMUSG00000018479
Gene NameRIKEN cDNA 1700125H20 gene
Synonyms
MMRRC Submission 040612-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R3161 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location85170404-85181145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85173284 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 84 (S84G)
Ref Sequence ENSEMBL: ENSMUSP00000018623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018623] [ENSMUST00000100681]
Predicted Effect probably damaging
Transcript: ENSMUST00000018623
AA Change: S84G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000018623
Gene: ENSMUSG00000018479
AA Change: S84G

DomainStartEndE-ValueType
DUF4208 31 134 1.43e-35 SMART
low complexity region 211 230 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100681
SMART Domains Protein: ENSMUSP00000098248
Gene: ENSMUSG00000018479

DomainStartEndE-ValueType
Blast:DUF4208 1 24 1e-7 BLAST
low complexity region 101 120 N/A INTRINSIC
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700066M21Rik T A 1: 57,383,075 N203K probably benign Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgrl2 G A 3: 148,817,551 L1354F probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Aox2 G T 1: 58,304,438 V427L possibly damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
Bptf A T 11: 107,074,476 D1182E probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Ciz1 A G 2: 32,370,063 D207G probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crabp2 A T 3: 87,952,177 K45* probably null Het
Daam1 C A 12: 71,947,098 T425K unknown Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dlg4 G C 11: 70,017,225 R4T probably damaging Het
Fbf1 A G 11: 116,148,220 I743T probably damaging Het
Fen1 A G 19: 10,200,291 L263P probably damaging Het
G6pc2 A G 2: 69,220,112 N27S probably damaging Het
Garnl3 A T 2: 33,034,711 N246K probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Gpr152 A G 19: 4,142,714 T85A probably benign Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Ighv1-81 C G 12: 115,920,329 E101Q probably benign Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Myo9a C T 9: 59,832,315 probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr213 C T 6: 116,540,846 A131V probably damaging Het
Olfr262 T C 19: 12,241,496 H55R probably benign Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Phyh T A 2: 4,937,671 probably benign Het
Pkp4 G T 2: 59,308,105 R233M probably damaging Het
Plcb1 A T 2: 135,335,482 Q578L probably benign Het
Ppil3 A T 1: 58,434,414 N92K probably benign Het
Prokr1 C T 6: 87,588,431 R144H probably damaging Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Sult2a4 T C 7: 13,989,471 T40A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Ttn A G 2: 76,833,237 probably benign Het
Vmn2r115 T A 17: 23,357,024 M532K possibly damaging Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wipf1 C T 2: 73,434,949 E437K probably damaging Het
Wls G T 3: 159,897,436 C162F probably damaging Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zfp868 A G 8: 69,612,085 S200P probably benign Het
Other mutations in 1700125H20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01490:1700125H20Rik APN 11 85178312 missense probably damaging 0.97
IGL01745:1700125H20Rik APN 11 85172870 missense probably benign 0.02
R0178:1700125H20Rik UTSW 11 85178438 missense probably benign 0.09
R1614:1700125H20Rik UTSW 11 85172864 missense possibly damaging 0.46
R5707:1700125H20Rik UTSW 11 85173312 missense probably benign 0.39
R5796:1700125H20Rik UTSW 11 85173275 missense probably null 0.77
R6033:1700125H20Rik UTSW 11 85178372 missense probably damaging 1.00
R6033:1700125H20Rik UTSW 11 85178372 missense probably damaging 1.00
X0066:1700125H20Rik UTSW 11 85178349 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGTCAGGCCAACTTGTCAG -3'
(R):5'- ATCAGTGCTATCCTGACGGC -3'

Sequencing Primer
(F):5'- AGGCACTGGGGTCTGTC -3'
(R):5'- AGTGCTATCCTGACGGCTAGAG -3'
Posted On2015-01-23