Incidental Mutation 'R0908:Vmn1r11'
ID83388
Institutional Source Beutler Lab
Gene Symbol Vmn1r11
Ensembl Gene ENSMUSG00000115236
Gene Namevomeronasal 1 receptor 11
SynonymsV1rc3
MMRRC Submission 039066-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R0908 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location57133455-57139617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 57138064 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 201 (V201L)
Ref Sequence ENSEMBL: ENSMUSP00000154621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071304] [ENSMUST00000176954] [ENSMUST00000226968] [ENSMUST00000228235]
Predicted Effect probably damaging
Transcript: ENSMUST00000071304
AA Change: V238L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071272
Gene: ENSMUSG00000115236
AA Change: V238L

DomainStartEndE-ValueType
Pfam:V1R 28 293 4.5e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176954
AA Change: V238L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135192
Gene: ENSMUSG00000093635
AA Change: V238L

DomainStartEndE-ValueType
Pfam:V1R 28 293 9.7e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226968
AA Change: V238L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000228235
AA Change: V201L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T A 3: 138,070,077 F1676I probably damaging Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Atp8b3 T C 10: 80,520,084 T1265A probably benign Het
Cep112 T C 11: 108,664,497 V679A possibly damaging Het
Cts8 A T 13: 61,250,916 Y259N probably damaging Het
Depdc7 A G 2: 104,728,092 S195P probably benign Het
Dio2 A T 12: 90,729,648 C189S probably damaging Het
Dmc1 A G 15: 79,585,689 L189P probably damaging Het
Ehmt1 A G 2: 24,804,888 Y1016H probably damaging Het
Gle1 T C 2: 29,936,121 S71P probably benign Het
Gykl1 T A 18: 52,695,369 *550K probably null Het
Klhl32 T C 4: 24,682,092 D197G probably damaging Het
Krt78 G A 15: 101,950,901 T287M probably damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Mrpl1 A T 5: 96,262,083 I272L probably benign Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Olfr596 T C 7: 103,310,573 V284A possibly damaging Het
Olfr937 T C 9: 39,059,947 T240A probably damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Pde5a A T 3: 122,779,001 I344L probably benign Het
Prl7c1 A G 13: 27,773,734 I241T possibly damaging Het
Rp1 T C 1: 4,344,655 E2078G probably benign Het
Scamp3 T C 3: 89,179,439 probably null Het
Sept8 A G 11: 53,537,870 H414R probably benign Het
Spata5 T A 3: 37,431,623 probably null Het
Spef2 T A 15: 9,614,195 probably null Het
Txlnb A G 10: 17,799,177 N26S probably damaging Het
Other mutations in Vmn1r11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02134:Vmn1r11 APN 6 57138037 missense possibly damaging 0.66
IGL02141:Vmn1r11 APN 6 57137379 nonsense probably null
IGL03147:Vmn1r11 UTSW 6 57137665 missense probably damaging 0.98
R1185:Vmn1r11 UTSW 6 57137507 missense possibly damaging 0.89
R1185:Vmn1r11 UTSW 6 57137507 missense possibly damaging 0.89
R1185:Vmn1r11 UTSW 6 57137507 missense possibly damaging 0.89
R1347:Vmn1r11 UTSW 6 57137978 missense probably benign 0.23
R1347:Vmn1r11 UTSW 6 57137978 missense probably benign 0.23
R1348:Vmn1r11 UTSW 6 57137978 missense probably benign 0.23
R1349:Vmn1r11 UTSW 6 57137978 missense probably benign 0.23
R1373:Vmn1r11 UTSW 6 57137978 missense probably benign 0.23
R1497:Vmn1r11 UTSW 6 57137409 missense probably damaging 1.00
R2147:Vmn1r11 UTSW 6 57137598 missense probably benign 0.29
R2367:Vmn1r11 UTSW 6 57137431 missense probably benign 0.00
R3087:Vmn1r11 UTSW 6 57137706 missense possibly damaging 0.94
R4445:Vmn1r11 UTSW 6 57137530 missense probably benign 0.31
R4667:Vmn1r11 UTSW 6 57137498 missense probably damaging 1.00
R4769:Vmn1r11 UTSW 6 57137612 missense probably damaging 1.00
R5513:Vmn1r11 UTSW 6 57137632 missense probably damaging 0.97
R5841:Vmn1r11 UTSW 6 57137802 missense probably damaging 1.00
R6089:Vmn1r11 UTSW 6 57137660 missense possibly damaging 0.95
R7155:Vmn1r11 UTSW 6 57138162 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ACCAATGTGAGTGAGACTAACCAGATGA -3'
(R):5'- GCTAGaccaacatggcacctaccc -3'

Sequencing Primer
(F):5'- TGAGACTAACCAGATGAAAGTCAC -3'
(R):5'- acctacccccacctgaaac -3'
Posted On2013-11-08