Incidental Mutation 'R2899:Clmp'
ID 261411
Institutional Source Beutler Lab
Gene Symbol Clmp
Ensembl Gene ENSMUSG00000032024
Gene Name CXADR-like membrane protein
Synonyms 9030425E11Rik
MMRRC Submission 040487-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R2899 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 40597258-40696615 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40693688 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 302 (S302P)
Ref Sequence ENSEMBL: ENSMUSP00000034522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034522]
AlphaFold Q8R373
Predicted Effect probably damaging
Transcript: ENSMUST00000034522
AA Change: S302P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034522
Gene: ENSMUSG00000032024
AA Change: S302P

DomainStartEndE-ValueType
IG 19 128 3.46e-7 SMART
IGc2 143 214 1.29e-6 SMART
transmembrane domain 233 255 N/A INTRINSIC
low complexity region 287 313 N/A INTRINSIC
low complexity region 321 332 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149386
Meta Mutation Damage Score 0.1700 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane protein that is localized to junctional complexes between endothelial and epithelial cells and may have a role in cell-cell adhesion. Expression of this gene in white adipose tissue is implicated in adipocyte maturation and development of obesity. This gene is also essential for normal intestinal development and mutations in the gene are associated with congenital short bowel syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a targeted null allele exhibit reduced viability, bilateral hydronephrosis, increased mean systolic blood pressure, and exhibit several blood chemistry and neurological anomalies. Null mice are samller than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,771,443 (GRCm39) K211E probably benign Het
Amigo3 T C 9: 107,931,353 (GRCm39) S259P probably benign Het
Bahd1 C T 2: 118,746,887 (GRCm39) P169S probably damaging Het
Cd200r4 T C 16: 44,653,728 (GRCm39) I175T probably damaging Het
Cep131 T C 11: 119,962,854 (GRCm39) D425G probably benign Het
Dusp6 T C 10: 99,099,707 (GRCm39) S52P probably damaging Het
Epha5 T A 5: 84,381,667 (GRCm39) I395F probably damaging Het
F5 A G 1: 164,014,469 (GRCm39) E580G possibly damaging Het
Fbxo3 T A 2: 103,881,480 (GRCm39) Y271N probably damaging Het
Fuca1 G A 4: 135,650,323 (GRCm39) W131* probably null Het
Gdf7 C T 12: 8,348,470 (GRCm39) A276T unknown Het
Limk1 A T 5: 134,717,154 (GRCm39) probably null Het
Lrrc37a G A 11: 103,388,690 (GRCm39) T2245I unknown Het
Neb A G 2: 52,075,335 (GRCm39) I210T probably benign Het
Nf1 T G 11: 79,303,584 (GRCm39) N420K possibly damaging Het
Or5b101 T A 19: 13,005,058 (GRCm39) I212F probably damaging Het
Pask G T 1: 93,262,269 (GRCm39) T197K probably damaging Het
Potefam1 C A 2: 111,051,015 (GRCm39) probably benign Het
Pou4f3 T C 18: 42,528,588 (GRCm39) L177P probably benign Het
Rassf1 G A 9: 107,431,393 (GRCm39) G107R probably null Het
Rdx T C 9: 51,980,211 (GRCm39) probably benign Het
Saraf T C 8: 34,628,385 (GRCm39) L77P probably damaging Het
Syngap1 A G 17: 27,178,959 (GRCm39) E483G probably damaging Het
Tsku T C 7: 98,002,124 (GRCm39) N69S probably damaging Het
Usp36 G A 11: 118,167,582 (GRCm39) probably benign Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Zc3h6 T C 2: 128,844,152 (GRCm39) V232A probably benign Het
Zfp143 T A 7: 109,671,336 (GRCm39) S99R probably damaging Het
Zkscan3 A T 13: 21,578,143 (GRCm39) L219Q probably damaging Het
Other mutations in Clmp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Clmp APN 9 40,693,906 (GRCm39) makesense probably null
IGL01783:Clmp APN 9 40,693,703 (GRCm39) missense possibly damaging 0.91
IGL02565:Clmp APN 9 40,683,711 (GRCm39) missense probably damaging 1.00
IGL02953:Clmp APN 9 40,685,683 (GRCm39) missense probably damaging 1.00
IGL02976:Clmp APN 9 40,692,520 (GRCm39) missense possibly damaging 0.92
IGL03357:Clmp APN 9 40,597,623 (GRCm39) utr 5 prime probably benign
IGL03383:Clmp APN 9 40,685,737 (GRCm39) missense probably damaging 1.00
R0530:Clmp UTSW 9 40,672,302 (GRCm39) missense probably benign 0.00
R0539:Clmp UTSW 9 40,693,782 (GRCm39) missense probably benign 0.00
R1453:Clmp UTSW 9 40,693,737 (GRCm39) missense probably damaging 0.98
R1623:Clmp UTSW 9 40,693,856 (GRCm39) missense probably benign
R4175:Clmp UTSW 9 40,682,432 (GRCm39) missense probably benign 0.04
R5570:Clmp UTSW 9 40,683,826 (GRCm39) critical splice donor site probably null
R6048:Clmp UTSW 9 40,682,405 (GRCm39) missense probably damaging 1.00
R6240:Clmp UTSW 9 40,693,707 (GRCm39) missense probably damaging 1.00
R6551:Clmp UTSW 9 40,682,573 (GRCm39) missense probably benign
R7216:Clmp UTSW 9 40,672,205 (GRCm39) missense possibly damaging 0.62
R8179:Clmp UTSW 9 40,692,475 (GRCm39) missense probably benign 0.31
R8813:Clmp UTSW 9 40,692,549 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTTAACTGACTGCCTTGGAG -3'
(R):5'- ACAGTTTGGAAGGCTTTGCTC -3'

Sequencing Primer
(F):5'- AACTGACTGCCTTGGAGGTTTATG -3'
(R):5'- AAGGCTTTGCTCTGGCTG -3'
Posted On 2015-01-23