Incidental Mutation 'R2899:Dusp6'
ID 261415
Institutional Source Beutler Lab
Gene Symbol Dusp6
Ensembl Gene ENSMUSG00000019960
Gene Name dual specificity phosphatase 6
Synonyms 1300019I03Rik, MKP-3, PYST1, MKP3
MMRRC Submission 040487-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.423) question?
Stock # R2899 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 99099093-99103351 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99099707 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 52 (S52P)
Ref Sequence ENSEMBL: ENSMUSP00000151438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020118] [ENSMUST00000220291]
AlphaFold Q9DBB1
Predicted Effect possibly damaging
Transcript: ENSMUST00000020118
AA Change: S52P

PolyPhen 2 Score 0.657 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020118
Gene: ENSMUSG00000019960
AA Change: S52P

DomainStartEndE-ValueType
RHOD 20 145 3.06e-13 SMART
low complexity region 151 187 N/A INTRINSIC
DSPc 206 346 5.51e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220218
Predicted Effect probably damaging
Transcript: ENSMUST00000220291
AA Change: S52P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.4423 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which are associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product inactivates ERK2, is expressed in a variety of tissues with the highest levels in heart and pancreas, and unlike most other members of this family, is localized in the cytoplasm. Mutations in this gene have been associated with congenital hypogonadotropic hypogonadism. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous or heterozygous for a null mutation display partial penetrance of postnatal lethality, reduced body weight, and abnormal growth plate morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 137,771,443 (GRCm39) K211E probably benign Het
Amigo3 T C 9: 107,931,353 (GRCm39) S259P probably benign Het
Bahd1 C T 2: 118,746,887 (GRCm39) P169S probably damaging Het
Cd200r4 T C 16: 44,653,728 (GRCm39) I175T probably damaging Het
Cep131 T C 11: 119,962,854 (GRCm39) D425G probably benign Het
Clmp T C 9: 40,693,688 (GRCm39) S302P probably damaging Het
Epha5 T A 5: 84,381,667 (GRCm39) I395F probably damaging Het
F5 A G 1: 164,014,469 (GRCm39) E580G possibly damaging Het
Fbxo3 T A 2: 103,881,480 (GRCm39) Y271N probably damaging Het
Fuca1 G A 4: 135,650,323 (GRCm39) W131* probably null Het
Gdf7 C T 12: 8,348,470 (GRCm39) A276T unknown Het
Limk1 A T 5: 134,717,154 (GRCm39) probably null Het
Lrrc37a G A 11: 103,388,690 (GRCm39) T2245I unknown Het
Neb A G 2: 52,075,335 (GRCm39) I210T probably benign Het
Nf1 T G 11: 79,303,584 (GRCm39) N420K possibly damaging Het
Or5b101 T A 19: 13,005,058 (GRCm39) I212F probably damaging Het
Pask G T 1: 93,262,269 (GRCm39) T197K probably damaging Het
Potefam1 C A 2: 111,051,015 (GRCm39) probably benign Het
Pou4f3 T C 18: 42,528,588 (GRCm39) L177P probably benign Het
Rassf1 G A 9: 107,431,393 (GRCm39) G107R probably null Het
Rdx T C 9: 51,980,211 (GRCm39) probably benign Het
Saraf T C 8: 34,628,385 (GRCm39) L77P probably damaging Het
Syngap1 A G 17: 27,178,959 (GRCm39) E483G probably damaging Het
Tsku T C 7: 98,002,124 (GRCm39) N69S probably damaging Het
Usp36 G A 11: 118,167,582 (GRCm39) probably benign Het
Vmn2r129 G T 4: 156,686,692 (GRCm39) noncoding transcript Het
Zc3h6 T C 2: 128,844,152 (GRCm39) V232A probably benign Het
Zfp143 T A 7: 109,671,336 (GRCm39) S99R probably damaging Het
Zkscan3 A T 13: 21,578,143 (GRCm39) L219Q probably damaging Het
Other mutations in Dusp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02272:Dusp6 APN 10 99,101,881 (GRCm39) missense probably damaging 1.00
IGL02687:Dusp6 APN 10 99,102,044 (GRCm39) missense probably damaging 0.97
IGL02996:Dusp6 APN 10 99,100,628 (GRCm39) missense possibly damaging 0.52
IGL03024:Dusp6 APN 10 99,102,156 (GRCm39) missense probably damaging 0.97
R1134:Dusp6 UTSW 10 99,100,816 (GRCm39) missense probably damaging 0.98
R1695:Dusp6 UTSW 10 99,099,555 (GRCm39) start codon destroyed probably null 0.99
R2078:Dusp6 UTSW 10 99,099,686 (GRCm39) missense probably damaging 1.00
R3162:Dusp6 UTSW 10 99,099,944 (GRCm39) missense probably damaging 1.00
R3162:Dusp6 UTSW 10 99,099,944 (GRCm39) missense probably damaging 1.00
R4413:Dusp6 UTSW 10 99,099,786 (GRCm39) missense probably damaging 1.00
R4501:Dusp6 UTSW 10 99,100,457 (GRCm39) missense probably benign 0.41
R5175:Dusp6 UTSW 10 99,099,864 (GRCm39) missense possibly damaging 0.91
R5381:Dusp6 UTSW 10 99,102,129 (GRCm39) missense possibly damaging 0.46
R5560:Dusp6 UTSW 10 99,102,103 (GRCm39) missense probably damaging 0.97
R5820:Dusp6 UTSW 10 99,099,864 (GRCm39) missense possibly damaging 0.91
R7359:Dusp6 UTSW 10 99,099,927 (GRCm39) missense probably benign 0.01
R7398:Dusp6 UTSW 10 99,100,740 (GRCm39) missense probably damaging 1.00
R8075:Dusp6 UTSW 10 99,100,810 (GRCm39) missense possibly damaging 0.63
R8491:Dusp6 UTSW 10 99,102,081 (GRCm39) missense possibly damaging 0.66
R8826:Dusp6 UTSW 10 99,099,469 (GRCm39) start gained probably benign
R9084:Dusp6 UTSW 10 99,099,692 (GRCm39) missense probably benign 0.13
R9125:Dusp6 UTSW 10 99,102,074 (GRCm39) nonsense probably null
R9389:Dusp6 UTSW 10 99,099,839 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCGACTTGACTTCTGTGTCG -3'
(R):5'- AGTGTTCTCATTCCAGTCGCTG -3'

Sequencing Primer
(F):5'- GAGGCGGAATCAAACCCCG -3'
(R):5'- GCTATTCTCGTCGTACAGCAC -3'
Posted On 2015-01-23