Mutagenetix > Incidental Mutation

Incidental Mutation 'R2899:Rassf1'

261413

Institutional Source

Beutler Lab

Gene Symbol

Rassf1

Ensembl Gene

ENSMUSG00000010067

Gene Name

Ras association (RalGDS/AF-6) domain family member 1

Synonyms

Rassf1A, RDA32, REH3P21, Rassf1C, Rassf1B, 123F protein, NORE2A

MMRRC Submission

040487-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.137) question?

Stock #

R2899 (G1)

Quality Score

200

Status

Validated

Chromosome

Chromosomal Location

107428752-107439460 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 107431393 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 107 (G107R)

Ref Sequence

ENSEMBL: ENSMUSP00000113252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010188] [ENSMUST00000010211] [ENSMUST00000093786] [ENSMUST00000122225] [ENSMUST00000193303] [ENSMUST00000156198]

AlphaFold

Q99MK9

Predicted Effect

probably benign
Transcript: ENSMUST00000010188

SMART Domains

Protein: ENSMUSP00000010188
Gene: ENSMUSG00000010044

Domain	Start	End	E-Value	Type
Pfam:zf-MYND	394	430	1.1e-10	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000010211

SMART Domains

Protein: ENSMUSP00000010211
Gene: ENSMUSG00000010067

Domain	Start	End	E-Value	Type
low complexity region	98	115	N/A	INTRINSIC
RA	124	218	6.26e-24	SMART
PDB:4LGD\|H	219	264	3e-13	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000093786
AA Change: G103R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000091301
Gene: ENSMUSG00000010067
AA Change: G103R

Domain	Start	End	E-Value	Type
C1	44	101	4.7e-7	SMART
low complexity region	168	185	N/A	INTRINSIC
RA	194	288	6.26e-24	SMART
PDB:4LGD\|H	289	334	3e-12	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000121635

SMART Domains

Protein: ENSMUSP00000113037
Gene: ENSMUSG00000010067

Domain	Start	End	E-Value	Type
low complexity region	50	67	N/A	INTRINSIC
RA	76	170	6.26e-24	SMART
PDB:4LGD\|H	171	216	1e-13	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000122225
AA Change: G107R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000113252
Gene: ENSMUSG00000010067
AA Change: G107R

Domain	Start	End	E-Value	Type
C1	44	105	1.92e-3	SMART
low complexity region	172	189	N/A	INTRINSIC
RA	198	292	6.26e-24	SMART
Pfam:Nore1-SARAH	299	338	4.2e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125080

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125386

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180865

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193782

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191832

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192445

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129320

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195158

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144129

Predicted Effect

probably benign
Transcript: ENSMUST00000193303

Predicted Effect

probably benign
Transcript: ENSMUST00000156198

SMART Domains

Protein: ENSMUSP00000117722
Gene: ENSMUSG00000010067

Domain	Start	End	E-Value	Type
Blast:C1	44	83	6e-24	BLAST
SCOP:d1ptq__	52	82	5e-10	SMART

Meta Mutation Damage Score

0.1831

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

97% (30/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to the RAS effector proteins. Loss or altered expression of this gene has been associated with the pathogenesis of a variety of cancers, which suggests the tumor suppressor function of this gene. The inactivation of this gene was found to be correlated with the hypermethylation of its CpG-island promoter region. The encoded protein was found to interact with DNA repair protein XPA. The protein was also shown to inhibit the accumulation of cyclin D1, and thus induce cell cycle arrest. Several alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous and heterozygous null mice display increased tumor incidence, especially of lung adenomas and lymphomas, and increased sensitivity to chemically induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 137,771,443 (GRCm39)	K211E	probably benign	Het
Amigo3	T	C	9: 107,931,353 (GRCm39)	S259P	probably benign	Het
Bahd1	C	T	2: 118,746,887 (GRCm39)	P169S	probably damaging	Het
Cd200r4	T	C	16: 44,653,728 (GRCm39)	I175T	probably damaging	Het
Cep131	T	C	11: 119,962,854 (GRCm39)	D425G	probably benign	Het
Clmp	T	C	9: 40,693,688 (GRCm39)	S302P	probably damaging	Het
Dusp6	T	C	10: 99,099,707 (GRCm39)	S52P	probably damaging	Het
Epha5	T	A	5: 84,381,667 (GRCm39)	I395F	probably damaging	Het
F5	A	G	1: 164,014,469 (GRCm39)	E580G	possibly damaging	Het
Fbxo3	T	A	2: 103,881,480 (GRCm39)	Y271N	probably damaging	Het
Fuca1	G	A	4: 135,650,323 (GRCm39)	W131*	probably null	Het
Gdf7	C	T	12: 8,348,470 (GRCm39)	A276T	unknown	Het
Limk1	A	T	5: 134,717,154 (GRCm39)		probably null	Het
Lrrc37a	G	A	11: 103,388,690 (GRCm39)	T2245I	unknown	Het
Neb	A	G	2: 52,075,335 (GRCm39)	I210T	probably benign	Het
Nf1	T	G	11: 79,303,584 (GRCm39)	N420K	possibly damaging	Het
Or5b101	T	A	19: 13,005,058 (GRCm39)	I212F	probably damaging	Het
Pask	G	T	1: 93,262,269 (GRCm39)	T197K	probably damaging	Het
Potefam1	C	A	2: 111,051,015 (GRCm39)		probably benign	Het
Pou4f3	T	C	18: 42,528,588 (GRCm39)	L177P	probably benign	Het
Rdx	T	C	9: 51,980,211 (GRCm39)		probably benign	Het
Saraf	T	C	8: 34,628,385 (GRCm39)	L77P	probably damaging	Het
Syngap1	A	G	17: 27,178,959 (GRCm39)	E483G	probably damaging	Het
Tsku	T	C	7: 98,002,124 (GRCm39)	N69S	probably damaging	Het
Usp36	G	A	11: 118,167,582 (GRCm39)		probably benign	Het
Vmn2r129	G	T	4: 156,686,692 (GRCm39)		noncoding transcript	Het
Zc3h6	T	C	2: 128,844,152 (GRCm39)	V232A	probably benign	Het
Zfp143	T	A	7: 109,671,336 (GRCm39)	S99R	probably damaging	Het
Zkscan3	A	T	13: 21,578,143 (GRCm39)	L219Q	probably damaging	Het

Other mutations in Rassf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00940:Rassf1	APN	9	107,435,510 (GRCm39)	splice site	probably benign
R0570:Rassf1	UTSW	9	107,435,165 (GRCm39)	missense	probably damaging	1.00
R1548:Rassf1	UTSW	9	107,429,045 (GRCm39)	missense	probably benign	0.00
R1826:Rassf1	UTSW	9	107,435,392 (GRCm39)	missense	probably damaging	0.99
R2312:Rassf1	UTSW	9	107,434,749 (GRCm39)	missense	probably damaging	1.00
R3902:Rassf1	UTSW	9	107,432,039 (GRCm39)	missense	probably damaging	1.00
R4705:Rassf1	UTSW	9	107,435,066 (GRCm39)	missense	probably benign	0.04
R5491:Rassf1	UTSW	9	107,438,614 (GRCm39)	missense	possibly damaging	0.95
R5733:Rassf1	UTSW	9	107,435,213 (GRCm39)	missense	probably damaging	1.00
R5863:Rassf1	UTSW	9	107,435,023 (GRCm39)	missense	probably damaging	1.00
R5986:Rassf1	UTSW	9	107,429,021 (GRCm39)	missense	possibly damaging	0.51
R7571:Rassf1	UTSW	9	107,428,982 (GRCm39)	missense	possibly damaging	0.70
R7841:Rassf1	UTSW	9	107,438,744 (GRCm39)	makesense	probably null
R8086:Rassf1	UTSW	9	107,435,173 (GRCm39)	missense	probably benign	0.38
R8784:Rassf1	UTSW	9	107,435,041 (GRCm39)	missense	probably benign
R8880:Rassf1	UTSW	9	107,434,740 (GRCm39)	missense	probably damaging	0.99
R8979:Rassf1	UTSW	9	107,429,004 (GRCm39)	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CATGCTTGGATCCCTAACCG -3'
(R):5'- GATGCCGGGAAATTGATCACTG -3'

Sequencing Primer
(F):5'- CAAGTGTCCAGAGGTGCCTAAC -3'
(R):5'- ATCACTGGGGTGTTCATTATGCAC -3'

Posted On

2015-01-23