Phenotypic Mutation 'oscar' (pdf version)
Alleleoscar
Mutation Type nonsense
Chromosome3
Coordinate86,350,304 bp (GRCm38)
Base Change C ⇒ T (forward strand)
Gene Lrba
Gene Name LPS-responsive beige-like anchor
Synonym(s) Lba, D3Ertd775e
Chromosomal Location 86,224,680-86,782,692 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WDL-BEACH-WD (WBW) gene family. Its expression is induced in B cells and macrophages by bacterial lipopolysaccharides (LPS). The encoded protein associates with protein kinase A and may be involved in leading intracellular vesicles to activated receptor complexes, which aids in the secretion and/or membrane deposition of immune effector molecules. Defects in this gene are associated with the disorder common variable immunodeficiency-8 with autoimmunity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased numbers of myeloid-derived suppressor cells and regulatory T cells, abnormal NK cell physiology, impaired rejection of allogeneic, xenogeneic and missing self bone-marrow grafts, and resistance to acute graft vs host disease. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_030695, NM_001077688, NM_001077687; MGI: 1933162

Mapped Yes 
Amino Acid Change Glutamine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000103261] [ENSMUSP00000142179] [ENSMUSP00000142043] [ENSMUSP00000148618]
SMART Domains Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080
AA Change: Q1292*

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 211 377 4.6e-13 PFAM
Pfam:DUF4704 446 717 2.5e-109 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2049 7e-88 PFAM
Pfam:PH_BEACH 2075 2172 9.1e-31 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
WD40 2760 2798 1.79e-1 SMART
WD40 2801 2840 4.28e0 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080
AA Change: Q1292*

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 7.4e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.5e-92 PFAM
Pfam:PH_BEACH 2068 2172 7.5e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080
AA Change: Q1292*

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 8.1e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.6e-92 PFAM
Pfam:PH_BEACH 2068 2172 8.3e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
Predicted Effect probably null
Predicted Effect probably null
Meta Mutation Damage Score 0.59 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
DSS: sensitive day 10 22608502
DSS: sensitive day 7 22608502
Candidate Explorer Status CE: excellent candidate; human score: 2.5; ML prob: 0.9516
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All mutations/alleles(13) : Chemically induced (other)(1) Gene trapped(10) Radiation induced(1) Targeted(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Lrba APN 3 86359782 missense probably benign 0.00
IGL00788:Lrba APN 3 86327685 missense probably damaging 0.97
IGL01139:Lrba APN 3 86642662 missense possibly damaging 0.88
IGL01302:Lrba APN 3 86295400 missense probably damaging 1.00
IGL01612:Lrba APN 3 86776177 missense possibly damaging 0.89
IGL01718:Lrba APN 3 86351248 missense probably damaging 1.00
IGL01719:Lrba APN 3 86327596 splice site probably benign
IGL01730:Lrba APN 3 86741424 missense possibly damaging 0.89
IGL01735:Lrba APN 3 86327661 missense probably benign 0.28
IGL01875:Lrba APN 3 86310047 missense probably damaging 1.00
IGL01884:Lrba APN 3 86310412 missense possibly damaging 0.86
IGL02264:Lrba APN 3 86780262 missense probably damaging 0.99
IGL02638:Lrba APN 3 86325073 missense probably damaging 0.97
IGL02647:Lrba APN 3 86359731 missense probably benign 0.00
IGL02664:Lrba APN 3 86325731 missense possibly damaging 0.84
IGL02728:Lrba APN 3 86776049 missense probably damaging 0.99
IGL02730:Lrba APN 3 86328199 missense probably damaging 1.00
IGL02883:Lrba APN 3 86354206 missense probably damaging 1.00
IGL02883:Lrba APN 3 86445413 missense probably damaging 0.99
IGL02948:Lrba APN 3 86310384 splice site probably null
IGL03090:Lrba APN 3 86773141 missense probably benign 0.01
molasses UTSW 3 86354307 critical splice donor site probably null
oscar2 UTSW 3 86664458 nonsense probably null
P0023:Lrba UTSW 3 86417935 missense probably damaging 1.00
PIT4802001:Lrba UTSW 3 86664494 nonsense probably null
R0077:Lrba UTSW 3 86542688 missense probably damaging 0.99
R0189:Lrba UTSW 3 86368509 missense probably damaging 1.00
R0217:Lrba UTSW 3 86642722 missense probably damaging 1.00
R0349:Lrba UTSW 3 86540005 missense probably damaging 1.00
R0396:Lrba UTSW 3 86295179 missense probably damaging 1.00
R0417:Lrba UTSW 3 86715654 missense probably damaging 1.00
R0536:Lrba UTSW 3 86715532 missense probably damaging 1.00
R0712:Lrba UTSW 3 86297990 nonsense probably null
R0722:Lrba UTSW 3 86605989 critical splice donor site probably null
R0828:Lrba UTSW 3 86608370 synonymous probably null
R0927:Lrba UTSW 3 86780233 missense probably damaging 1.00
R1120:Lrba UTSW 3 86295192 missense probably damaging 1.00
R1141:Lrba UTSW 3 86619558 missense probably damaging 1.00
R1276:Lrba UTSW 3 86664526 missense probably damaging 1.00
R1449:Lrba UTSW 3 86354278 missense probably damaging 1.00
R1470:Lrba UTSW 3 86737142 missense probably damaging 1.00
R1470:Lrba UTSW 3 86737142 missense probably damaging 1.00
R1474:Lrba UTSW 3 86780266 splice site probably benign
R1558:Lrba UTSW 3 86351315 missense probably damaging 1.00
R1596:Lrba UTSW 3 86350304 nonsense probably null
R1652:Lrba UTSW 3 86539938 missense probably damaging 1.00
R1800:Lrba UTSW 3 86351868 missense probably benign 0.00
R1819:Lrba UTSW 3 86542634 missense possibly damaging 0.80
R1862:Lrba UTSW 3 86773203 critical splice donor site probably null
R1917:Lrba UTSW 3 86664501 missense probably damaging 1.00
R1965:Lrba UTSW 3 86605868 critical splice acceptor site probably null
R1966:Lrba UTSW 3 86605868 critical splice acceptor site probably null
R1969:Lrba UTSW 3 86608389 missense probably damaging 0.99
R2011:Lrba UTSW 3 86310017 missense probably damaging 0.99
R2179:Lrba UTSW 3 86354281 missense probably damaging 1.00
R2186:Lrba UTSW 3 86304336 missense probably damaging 1.00
R2281:Lrba UTSW 3 86776103 missense possibly damaging 0.46
R2359:Lrba UTSW 3 86348750 missense probably benign 0.01
R2412:Lrba UTSW 3 86327700 missense probably damaging 1.00
R2496:Lrba UTSW 3 86532087 missense probably damaging 1.00
R3153:Lrba UTSW 3 86285219 missense probably damaging 0.99
R3708:Lrba UTSW 3 86285024 missense possibly damaging 0.80
R3746:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3747:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3748:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3749:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3750:Lrba UTSW 3 86375953 missense probably damaging 1.00
R3758:Lrba UTSW 3 86776049 missense probably damaging 0.99
R3975:Lrba UTSW 3 86351255 missense probably damaging 1.00
R4210:Lrba UTSW 3 86360126 missense probably damaging 1.00
R4258:Lrba UTSW 3 86445349 missense probably damaging 1.00
R4657:Lrba UTSW 3 86737164 missense probably damaging 1.00
R4713:Lrba UTSW 3 86359868 missense probably benign 0.13
R4716:Lrba UTSW 3 86642714 missense probably damaging 0.99
R4811:Lrba UTSW 3 86776141 missense probably damaging 1.00
R4827:Lrba UTSW 3 86360150 missense possibly damaging 0.85
R4840:Lrba UTSW 3 86619509 critical splice acceptor site probably null
R4920:Lrba UTSW 3 86664458 nonsense probably null
R4948:Lrba UTSW 3 86285028 missense probably damaging 1.00
R4970:Lrba UTSW 3 86225371 missense probably benign 0.23
R4985:Lrba UTSW 3 86327436 intron probably null
R4993:Lrba UTSW 3 86360037 missense probably damaging 1.00
R5107:Lrba UTSW 3 86359779 missense possibly damaging 0.47
R5112:Lrba UTSW 3 86225371 missense probably benign 0.23
R5122:Lrba UTSW 3 86349154 nonsense probably null
R5155:Lrba UTSW 3 86351300 missense probably benign 0.25
R5194:Lrba UTSW 3 86328219 missense probably damaging 1.00
R5280:Lrba UTSW 3 86325022 missense possibly damaging 0.94
R5445:Lrba UTSW 3 86368595 missense probably benign
R5469:Lrba UTSW 3 86542641 missense probably damaging 1.00
R5513:Lrba UTSW 3 86542641 missense probably damaging 1.00
R5578:Lrba UTSW 3 86757507 missense probably benign 0.27
R5740:Lrba UTSW 3 86328342 missense probably damaging 1.00
R5868:Lrba UTSW 3 86319604 missense probably damaging 1.00
R6104:Lrba UTSW 3 86353792 missense probably damaging 1.00
R6166:Lrba UTSW 3 86354307 critical splice donor site probably null
R6279:Lrba UTSW 3 86348864 missense probably benign 0.26
R6330:Lrba UTSW 3 86348357 missense probably benign 0.07
R6367:Lrba UTSW 3 86368562 missense probably benign 0.42
R6571:Lrba UTSW 3 86360060 missense probably damaging 1.00
R6584:Lrba UTSW 3 86664576 missense probably damaging 1.00
R6698:Lrba UTSW 3 86304425 missense probably damaging 0.99
R6763:Lrba UTSW 3 86354263 missense probably damaging 1.00
R6834:Lrba UTSW 3 86350286 missense probably benign 0.00
R6951:Lrba UTSW 3 86745873 missense probably benign 0.01
R6969:Lrba UTSW 3 86619590 missense probably benign 0.21
R7045:Lrba UTSW 3 86285091 missense probably benign 0.03
R7133:Lrba UTSW 3 86394931 intron probably null
R7182:Lrba UTSW 3 86741458 frame shift probably null
R7214:Lrba UTSW 3 86328326 missense probably damaging 1.00
R7224:Lrba UTSW 3 86395246 missense probably damaging 1.00
R7350:Lrba UTSW 3 86351902 missense probably damaging 0.96
R7380:Lrba UTSW 3 86325074 missense probably damaging 1.00
X0065:Lrba UTSW 3 86297899 missense probably damaging 1.00
X0065:Lrba UTSW 3 86325089 missense possibly damaging 0.95
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2019-05-16 3:14 PM by Anne Murray
Record Created 2015-02-16 1:20 PM by Emre Turer
Record Posted 2019-05-16
Phenotypic Description
Figure 1. Oscar mice exhibit susceptibility to DSS-induced colitis 7 days after DSS exposure. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Oscar mice exhibit susceptibility to DSS-induced colitis 10 days after DSS exposure. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The oscar phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R1596, some of which showed susceptibility to dextran sodium sulfate (DSS)-induced colitis at 7 (Figure 1) and 10 days (Figure 2) after DSS exposure (1); weight loss is used to measure DSS susceptibility.

Nature of Mutation
Figure 3. Linkage mapping of the DSS susceptibility phenotype at day 7 using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 65 mutations (X-axis) identified in the G1 male of pedigree R1596. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.
Figure 4. CRISPR-Lrba knockout mice exhibit susceptibility to DSS-induced colitis 7 days after DSS exposure. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. CRISPR-Lrba knockout mice exhibit susceptibility to DSS-induced colitis 10 days after DSS exposure. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Whole exome HiSeq sequencing of the G1 grandsire identified 65 mutations. The DSS sensitivity phenotype was linked by continuous variable mapping to a mutation in Lrba: a C to T transition at base pair 86,350,304 (v38) on chromosome 3, or base pair 126,401 in the GenBank genomic region NC_000069 encoding Lrba. The strongest association was found with a recessive model of inheritance to the phenotype at day 7, wherein three variant homozygotes departed phenotypically from 16 homozygous reference mice and 11 heterozygous mice with a P value of 9.182 x 10-8 (Figure 3).  

 

The mutation corresponds to residue 4,159 in the mRNA sequence NM_030695 within exon 24 of 57 total exons.

 

4144 GATGCAGTAGACCAACAAAGGAGGGACTCCAGA

1287 -D--A--V--D--Q--Q--R--R--D--S--R-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of glutamine 1,292 for a premature stop codon (Q1292*) in the LRBA protein.

 

The causative mutation in Lrba for the DSS sensitivity phenotype at day 7 and day 10 was validated by CRISPR-mediated knockout of the Lrba (Figure 4 (P = 3.908 x 10-8) and Figure 5 (P = 5.435 x 10-8), respectively).

Protein Prediction
Figure 6. Domain organization of LRBA. The location of the oscar mutation is indicated. Domain information is from SMART and UniProt. This image is interactive; click to view additional mutations in Lrba.

Lrba encodes lipopolysaccharide-responsive beige-like anchor protein (LRBA), a member of the WD (tryptophan/aspartic acid) repeat-like (WDL)-BEACH [beige and Chediak-Higashi syndrome]-WD (WBW) gene family. LRBA has similar features of both Lyst (alternatively, CHS/Beige; see the record for souris) and A-kinase anchor proteins (AKAPs).

 

LRBA has a ConA-like domain, a VHS (VPS [vacuolar protein sorting]-27, Hrs [hepatocyte growth factor-regulated tyrosine kinase substrate], STAM [signal transducing adaptor molecule]) domain, a WDL domain, a DUF1088 (domain of unknown function 1088)  domain, a pleckstrin homology (PH) domain, a BEACH domain with a SH3-binding site, and five WD40 domains (Figure 6) (2-4). The ConA-like domain putatively regulates protein trafficking and classification of proteins along the secretory pathway (5). VHS domains are often found near the N-termini of proteins that function in endocytosis or vesicular trafficking (SMART). The VHS domain putatively functions as an adaptor domain that assists in promoting the localization of proteins in the cell membrane or in membranes of the endocytic machinery. WDL motifs consist of approximately 40 amino acids, and putatively function as protein interaction motifs. WDL motifs share similar structures to WD40 repeats. WD40 motifs typically form β sheets arranged in a 7-bladed β propeller fold (6). WD40 motifs are protein interaction motifs that function in signaling, cell cycle control, and apoptosis. The DUF1088 domain is near the LRBA C-terminus (4). The DUF1088 domain is unique to LRBA and its paralog neurobeachin. PH domains interact with phosphatidylinositol within membranes as well as with G-proteins and protein kinase C. These interactions facilitate protein targeting to the correct cellular compartments and signaling pathway activation. The BEACH domain is a 280-amino acid region of unknown function (7). BEACH domains are found in several proteins that function in vesicle trafficking, maintaining membrane dynamics, and receptor signaling. The ConA-like and PH-BEACH domains interact with the cytoplasmic tail of cytotoxic T lymphocyte-associated protein-4 (CTLA-4); see the Background section for more information about the LRBA-CTLA-4 interaction (8).

 

Mouse Lrba encodes three isoforms: alpha (9,903 base pair encoding 2,856 amino acids), beta (9,396 base pair encoding 2,792 amino acids), and gamma (8,854 base pair encoding 2,779 amino acids) (2). The three isoforms have identical 5’-ends, but differ at their 3’-termini. The alpha isoform has five WD repeats, the beta isoform has three, and the gamma isoform lacks WD repeats. All isoforms have a BEACH domain.

 

The oscar mutation results in substitution of tyrosine 2,356 for a premature stop codon (Y2356*) in the LRBA protein; amino acid 2,356 is within the BEACH domain.

Expression/Localization

LRBA is expressed in several tissues, including bone marrow, lymph nodes, spleen, fetal liver, placenta, kidney, and pancreas (9). LRBA expression is induced in B cells and macrophages by lipopolysaccharide (2). LRBA expression is increased in several types of cancers, including renal, pancreatic, colorectal lung, and central nervous system (10).

 

LRBA localizes to the cytosol, Golgi apparatus, and some lysosomes (2).

Background
Figure 7. LRBA in the regulation of vesicular trafficking.

LRBA functions in the regulation of endosomal trafficking by mediating the endocytosis of ligand-activated receptors and immune effector molecules including CTLA-4 (Figure 7) (11). CLTA-4 is a receptor on activated T cells that regulates peripheral immune tolerance and homeostasis by inhibiting T cell activation (12). In unstimulated T cells CTLA-4 localizes to the Golgi apparatus, endosomes, secretory granules, and lysosomes. After T cell receptor stimulation, CTLA-4 traffics from vesicular compartments to the cell membrane. At the membrane, CTLA-4 is continuously endocytosed via clathrin-coated vesicles. Some endocytosed CTLA-4 are recycled to the cell membrane, while some are degraded by lysosomes (13). LRBA regulates recycling of CTLA-4 from endosomes to the cell membrane. Furthermore, LRBA putatively blocks trafficking of CTLA-4 to lysosomes and competes with AP-1 for CLTA-4 binding (8).

 

LRBA also putatively functions in the vesicular trafficking of epidermal growth factor receptor (EGFR; see the record for Velvet) (10). EGFR signaling is activated by a variety of ligands and activates several signaling pathways leading to gene transcription, cell proliferation and cell migration. Ligand binding induces the formation of EGFR homo- or heterodimers and the activation of intrinsic receptor tyrosine kinase activity, resulting in trans-phosphorylation of cytoplasmic tyrosine residues. Trans-phosphorylation of receptor tyrosines creates binding sites for SH2 domain- and PTB domain-containing proteins which recruit complexes that propagate downstream signaling. Their binding leads to substrate phosphorylation and the activation of multiple pathways, including the Ras-MAPK, Src and Abl family kinase, JNK, STAT and PLC-γ pathways. These in turn regulate transcriptional programs controlling cell proliferation, death and differentiation, as well as signaling cascades controlling cell adhesion, motility and migration. Termination of signaling from the EGFR is mediated by receptor endocytosis (14;15). EGFR expression at the cell surface is regulated by clathrin-mediated endocytosis, resulting in either its lysosomal degradation or recycling to the cell surface (16). LRBA mutations result in reduced expression and phosphorylation of EGFR (10); however, it is unknown if LRBA and EGFR directly interact.

 

Mutations in LRBA are linked to common variable immunodeficiency 8 with autoimmunity (CVID8; OMIM: #614700) (8;9;11;17;18). Patients with CVID8 have recurrent infections starting in early childhood and also can develop autoimmune disorders, including idiopathic thrombocytopenia purpura, autoimmune hemolytic anemia, and inflammatory bowel disease [(9); reviewed in (18;19)].  CVID8 patients can also have hypogammaglobulinemia, reduced numbers of switched memory B cells, and reduced numbers of CD4+ regulatory T cells (9;17). B cells from the patients showed a failure to proliferate, differentiate, or produce antibodies as well as an increased susceptibility to apoptosis (9). Mutations in LRBA are also linked to an autoimmune lymphoproliferative-like syndrome in which patients showed splenomegaly, lymphadenopathy, cytopenia, increased numbers of double-negative T cells, increased levels of Fas ligand (FasL; see the record for riogrande) in the serum, and impaired Fas (see the record for cherry)-mediated apoptosis (20). Mutations in LRBA are also linked to cases of autoimmunity (autoimmune lymphoproliferative syndrome) presenting as neonatal diabetes (21) as well as cases of early-onset chronic erosive polyarthritis (22). A homozygous LRBA mutation (c.2445_2447del(C)3ins(C)2, p.P816Lfs*4) was identified in two siblings that exhibited infancy-onset type 1 diabetes, enteropathy, growth hormone deficiency, short stature, and immunodysregulation (18;23). An LRBA mutation (p.I2824P) that resulted in normal expression of the mutant protein was linked to early IBD-like symptoms; the patient did not exhibit overt immunodeficiency (24).

 

Lrba-deficient (Lrba-/-) mice exhibited increased regulatory T cell numbers in the small intestine, increased myeloid-derived suppressor cell numbers in the spleen and mesenteric lymph nodes (25). Lrba-deficient mice exhibited reduced susceptibility to graft versus host disease challenge and impaired rejection of bone marrow grafts from mismatched donors as well as aberrant NK cell-mediated cytotoxicity (25). Lrba-/- mice showed progressive sensorineural hearing loss due to degermation of inner and outer hair cell stereociliary bundles (26). Lrba-/- mice showed normal responses to T-dependent and T-independent antigens as well as normal responses to acute infections with lymphocytic choriomeningitis virus or Salmonella typhimurium (27). The mice had normal levels of serum IgM and IgG, but had elevated serum and secretory basal IgA levels. The mice showed normal B and T cell development, B cell proliferation, B cell survival, isotype switching, and plasmablast differentiation. The mice showed reduced CTLA-4 expression in regulatory T cells and activated conventional CD4+ and CD8+ T cells, reduced peritoneal B-1a cell frequency, reduced IL-10 production, and increased percentages of T follicular helper cells in Peyer’s patches (27;28). The mice did not develop overt signs of autoimmunity. Lrba-/- mice showed compromised olfaction due to reduced concentrations of all three subunits (i.e., aolf, b1, and g13) of the olfactory heterotrimeric G protein (Golf) in the sensory cilia of olfactory neurons; the cilia morphology and the concentrations of other ciliary proteins were not changed (29).

Putative Mechanism

Increased signaling from one or more of the endosomal TLRs (TLR3, TLR7, and TLR9) resulted in increased production of inflammatory cytokines and increased susceptibility to DSS-induced colitis in Lrba-/-  mice (1). DSS-treated Lrba-/- mice showed increased infiltration of inflammatory cells in the colon as well as impaired epithelial cell architecture in the colon. The DSS-treated Lrba-/  colon showed increased expression levels of pro-inflammatory cytokines, including TNF, IL-6, IL-1-b, IFN-a, IFN-b, and IFN-g. T and B cells were not necessary for the development of DSS-induced colitis in the Lrba-/- mice. However, LRBA function in innate immune cells, namely macrophages and dendritic cells, was required for recovery and restoration of intestinal homeostasis after DSS treatment. Excessive type I interferon in the Lrba-/- mice did not contribute to DSS susceptibility. However, PI3K/AKT/mTOR signaling was increased in the Lrba-/- dendritic cells, resulting in hyperactivation of IRF3 and IRF7 in response to endosomal TLR stimulation and subsequent increased production of type I IFN, IFN-stimulated genes, and IRF-dependent cytokines.

Primers PCR Primer
oscar(F):5'- GGCGATGTCTCTAATAACATGGCCC -3'
oscar(R):5'- AAGCGCCATTGGAATACCTACCTTC -3'

Sequencing Primer
oscar_seq(F):5'- ACATGGCCCTATGCTAATTACTG -3'
oscar_seq(R):5'- GGGTTTGTAGTCCAGAAATTCCAC -3'
Genotyping

NOTE: These primers have not been validated.

 

Primer ID: R15960017

 

Oscar genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

Oscar (F): 5’- GGCGATGTCTCTAATAACATGGCCC-3’

Oscar (R): 5’- AAGCGCCATTGGAATACCTACCTTC-3’

 

Sequencing Primers

Oscar_seq(F): 5’- ACATGGCCCTATGCTAATTACTG-3’
 

Oscar_seq(R): 5’- GGGTTTGTAGTCCAGAAATTCCAC-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 711 nucleotides is amplified (Chr.3: 86350000-86350710, GRCm38; NCBI RefSeq: NC_000069):

 

ggcgatgtct ctaataacat ggccctatgc taattactgt tgatttatgg tattagcatt       

ataccatgat aactttgctt taaatttatg gtaagattag tcattgataa gtttctttta      

attttacttt gtagtgtatt agaatttgaa tatttgttag atgcatttca gggaagttat      

gaattctgtg ctgatgcctt cttttgaagt tcaacttact ttattagttc ttaacctttt      

ctcttagata tcaaggcaac aggagcagac agcacaagga acagcaccag atgcagtaga      

ccaacaaagg agggactcca gatccaccat gtttcgcatt cctgagttca agtggtctca      

gatgcatcaa cgtctgctca ctgatctctt attttccata gaaacagata tacagatgtg      

gagaaggttt gttcatatat tcactataga atacatgtat gaagcttagt ctttgttttc      

aaagaaattt gtgtaaacat tttatattac cccaaacatt tgattgaaaa aaaagactat      

aaattactct atgttagtat tctatcacat taccatttat cctccattct atgtgtggaa      

tttctggact acaaacccag gaaaatccaa gatttcctgt actaaaaatt gctcgaggtt      

tgttatagta tttatagaat tagctagaag gtaggtattc caatggcgct t

 

FASTA sequence

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated C is shown in red text (C>T).

References
  6. Sondek, J., Bohm, A., Lambright, D. G., Hamm, H. E., and Sigler, P. B. (1996) Crystal Structure of a G-Protein Beta Gamma Dimer at 2.1A Resolution. Nature. 379, 369-374.
  14. Das, M., and Fox, C. F. (1978) Molecular Mechanism of Mitogen Action: Processing of Receptor Induced by Epidermal Growth Factor. Proc Natl Acad Sci U S A. 75, 2644-2648.
  15. Baulida, J., Kraus, M. H., Alimandi, M., Di Fiore, P. P., and Carpenter, G. (1996) All ErbB Receptors Other than the Epidermal Growth Factor Receptor are Endocytosis Impaired. J Biol Chem. 271, 5251-5257.
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsEmre Turer, William McAlpine, Noelle Hutchins, Jeff SoRelle, and Bruce Beutler