Screen | Double-stranded DNA Macrophage Screen | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Common Name | dsDNA Macrophage | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Posted On | 02/18/2010 12:24 PM | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Author | Owen M. Siggs, Hexin Shi | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writer | Nora G. Smart | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
As in our Toll-like Receptor (TLR) signaling screen, stimulated ex vivo thioglycolate-elicited peritoneal cells are used to discover components involved in sensing cytoplasmic double-stranded DNA (dsDNA). While a non-redundant cytoplasmic sensor remains to be found, dsDNA is known to induce production of type I interferon through a TANK-binding kinase 1 (TBK1)-, inhibitor of NF-κB kinase ε (IKKε)-, and interferon regulatory factor 3 (IRF3)-dependent pathway (1;2). This occurs independently of TLR signaling. The dsDNA macrophage screen is designed to probe for additional components of this pathway by isolating macrophages from N-ethyl-N-nitrosourea (ENU)-mutagenized mice, stimulating them with dsDNA and assaying the production of type I interferon. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Reagents and Solutions | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Brewer’s thioglycolate medium, 4%
4% (w/v) Brewer’s thioglycolate medium powder (BBL Microbiology Systems, Cockeysville, MD) is added to distilled water pre-warmed to 37°C. Solution is autoclaved to sterilize and stored away from light.
PEC recovery solution
Hepes-buffered saline solution (Gibco, Invitrogen, Carlsbad, CA )
5% (v/v) heat-inactivated fetal bovine serum (Atlanta Biologicals, Lawrenceville, GA)
200 IU/mL penicillin (Gibco)
200 mg/mL streptomycin (Gibco)
PEC medium
Dulbecco’s modified eagle medium (Mediatech Inc., Herndon, VA)
5% (v/v) heat-inactivated fetal bovine serum
200 IU/mL penicillin
200 mg/mL streptomycin
L-929 medium
Dulbecco’s modified eagle medium
10% (v/v) heat-inactivated fetal bovine serum
200 IU/mL penicillin
200 mg/mL streptomycin
Cycloheximide solution
10mg/mL cycloheximide (Sigma) in sterile PBS, and diluted 1:25 in L-929 medium immediately prior to use.
MTT solution
2mg MTT (Sigma)/mL sterile PBS.
Lysis solution
90% (v/v) isopropanol
0.5% (w/v) SDS
0.04N HCl
Adjust volume with distilled water.
dsDNA (IDT, San Diego, CA)
TGTAGATCATGTACAGATCAGTCATAGATCACTAGTAGATCTGTA duplex, 1μg/μL stock.
L-929 cells (ATCC #CCL-1)
OptiMEM (Gibco)
Lipofectamine 2000 (Invitrogen, Carlsbad, CA)
IFNβ standards (eBioscience, San Diego, CA, cat #14-8311-63)
Reporter Lysis buffer (Promega, Madison, WI)
Luciferase Assay System solution (Promega)
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Method | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Peritoneal exudate cell (PEC) isolation
Activation with dsDNA
Table 1 | Type 1 interferon ELISA plate layout
Type 1 IFN bioassay
Bioactive type 1 IFN concentrations are inferred from the standard curve of [IFNβ] versus ISRE-dependent luminescence. For PEC plates, the absorbance values provide an indication of the number of live cells used in the IFN bioassay. To adjust for sample to sample variation in PEC number (which may affect the amount of IFN produced), the calculated IFN concentrations must be normalized. Average absorbance of each PEC sample (e.g. average absorbance of columns 1 and 2, 3 and 4, 5 and 6, etc. on PEC plate) is divided by the total average absorbance across all PEC plates. The resulting figure is used to normalize each IFN concentration value. Typically, samples falling outside three standard deviations of the mean are considered putative mutants, and leftover PEC solution may be used for ligand dose-response retesting. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Critical Parameters and Troubleshooting | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Thioglycolate preparation
Thioglycolate solution should be carefully prepared to ensure maximal PEC recovery. Solvent should be warmed to 37°C prior to solute addition to assist solubility, and subsequently autoclaved at least once, since this increases inflammatory potential (3). Aging the solution for at least 1 month also enhances activity (4), in which case it should be stored away from light and at room temperature.
L-929 cell renewal
Once received from source, L-929 cells should first be tested for sensitivity to IFNβ. Once confirmed, sensitive cells should be expanded and stored in liquid nitrogen in multiple aliquots. Since L-929 cells lose their sensitivity to IFNβ over time, these aliquots may be thawed as required.
Retesting
While stimulated PEC supernatants may be stored indefinitely at -20°C, PECs stored at 4°C remain viable and responsive to stimulation for up to four days. Prompt completion of the initial assay therefore allows any remaining cells to be used for confirmation of putative mutants. A minimum of three weeks should be allowed between thioglycolate injections to allow for sufficient PEC recovery.
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Identified | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
logimen
macro-2 Olive Reef shook |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||