Phenotypic Mutation 'Mooyah2' (pdf version)
AlleleMooyah2
Mutation Type missense
Chromosome5
Coordinate75,652,808 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Kit
Gene Name KIT proto-oncogene receptor tyrosine kinase
Synonym(s) SCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
Chromosomal Location 75,574,916-75,656,722 bp (+)
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001122733.1NM_021099.3; MGI: 96677

Mapped Yes 
Amino Acid Change Isoleucine changed to Asparagine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000005815] [ENSMUSP00000116465]
PDB Structure
Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: I885N

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000005815)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: I881N

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000144270)
Meta Mutation Damage Score 0.276 question?
Is this an essential gene? Probably essential (E-score: 0.949) question?
Phenotypic Category
Phenotypequestion? Literature verified References
pigmentation
skin/coat/nails
Candidate Explorer Status CE: failed initial filter
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(175) : Chemically induced (ENU)(17) Chemically induced (other)(3) Gene trapped(39) Radiation induced(2) Spontaneous(74) Targeted(36) Transgenic(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.00
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.98
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense possibly damaging 0.66
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign
IGL03381:Kit APN 5 75607128 missense probably benign 0.04
casper UTSW 5 75645875 missense probably damaging 1.00
pretty2 UTSW 5 75649550 missense probably damaging 1.00
slimmer UTSW 5 75640757 missense possibly damaging 0.94
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0254:Kit UTSW 5 75620921 missense probably benign
R0329:Kit UTSW 5 75652829 missense probably damaging 1.00
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1068:Kit UTSW 5 75609518 missense probably benign
R1115:Kit UTSW 5 75649532 splice site probably benign
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably null 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably null
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense probably benign 0.40
R5731:Kit UTSW 5 75654415 missense possibly damaging 0.93
R6270:Kit UTSW 5 75609509 missense probably benign
R6565:Kit UTSW 5 75645853 missense probably damaging 1.00
R6694:Kit UTSW 5 75640757 missense possibly damaging 0.94
R6805:Kit UTSW 5 75652808 missense probably damaging 1.00
R6823:Kit UTSW 5 75652649 missense probably benign 0.01
R6848:Kit UTSW 5 75607212 missense probably benign
R7021:Kit UTSW 5 75620967 missense probably benign 0.00
R7080:Kit UTSW 5 75607281 missense probably damaging 0.99
R7117:Kit UTSW 5 75607098 missense probably benign 0.18
R7156:Kit UTSW 5 75615374 missense probably benign 0.14
R7379:Kit UTSW 5 75647752 missense probably damaging 1.00
U24488:Kit UTSW 5 75623014 nonsense probably null
Mode of Inheritance Unknown
Local Stock Live Mice
Repository
Last Updated 2019-09-04 9:26 PM by Diantha La Vine
Record Created 2019-04-19 10:23 AM by Jamie Russell
Record Posted 2019-05-08
Phenotypic Description
Figure 1. Mooyah2 mice have piebald coats.

The mooyah2 phenotype was identified among G3 mice of the pedigree R6805, some of which showed piebald coats (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the piebald coat phenotype using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 63 mutations (X-axis) identified in the G1 male of pedigree R6805. Binary data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 63 mutations. The piebald phenotype was linked to mutations in two genes on chromosome 5: Kit and Dspp. The mutation in Kit was presumed causative as the mooyah2 piebald coat phenotype mimics other known alleles of Kit (see MGI for a list of Kit alleles). The mutation in Kit is a T to A transversion at base pair 75,652,808 (v38) on chromosome 5, or base pair 77,822 in the GenBank genomic region NC_000071.6 encoding Kit. The strongest association was found with an unknown (additive/dominant) model of inheritance (P = 2.329 x 10-6), wherein 11 affected mice were heterozygous for the variant allele, and 12 unaffected mice were homozygous for the reference allele (Figure 2); no homozygous variant mice were alive at time of screening.

 

The mutation corresponds to residue 2,703 in the mRNA sequence NM_021099.3 within exon 19 of 21 total exons.

 

2687 AAGTTCTACAAGATGATCAAGGAAGGCTTCCGG

876  -K--F--Y--K--M--I--K--E--G--F--R-

 

The mutated nucleotide is indicated in red. The mutation results in an isoleucine to asparagine substitution at position 881 (I881N) in the KIT protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Protein Prediction
Figure 3. Domain structure of KIT. The position of the Mooyah2 mutation is indicated. Click on the image to view other mutations found in Kit.
Figure 4. Crystal structure of the KIT/SCF complex. The KIT extracellular domains are shown in blue, while the two SCF molecules are shown in green. β-strands are represented by arrows and α-helices by coils. UCSF Chimera model is based on PDB 2E9W, Yuzawa et al., Cell. 130, 232-334 (2007). Click on the 3D structure to view it rotate.

KIT is a 975 amino acid protein of the class III receptor tyrosine kinase (RTK) family, which contains five extracellular immunoglobulin (Ig) domains, a single transmembrane domain, a split tyrosine kinase domain, and a unique distribution of cysteine residues within the ligand binding domain (Figure 3) (1;2). The N terminus of KIT (residues 1-23) contains a signal peptide followed by the mature 953 amino acid KIT polypeptide (3). The kinase domains of class III RTKs are divided into two regions separated by an inserted sequence that varies in length between members and is thought to contribute to substrate specificity. As in the FMS and PDGF receptors, the KIT tyrosine kinase domain contains an insert of 77 hydrophilic amino acids bisecting the kinase domain (3). The KIT tyrosine kinase domain has the characteristic bi-lobed architecture of all protein kinases (Figure 4; PDB ID 1PKG). Residues 582-671 comprise the small N-terminal lobe (N-lobe), and residues 678-953 comprise the large C-terminal lobe (C-lobe) [(4;5) and reviewed in (6)]. The cleft created between the two lobes contains the catalytic site. 

 

The mooyah2 mutation results in an isoleucine to asparagine substitution at position 881 (I881N) in the KIT protein; Iso881 is within the C-lobe of the kinase domain.

 

Please see the record Pretty2 for more information about Kit.

Putative Mechanism

Signal transduction from KIT begins with the binding of an SCF (see the record for mooyah) homodimer, which leads to receptor dimerization and activation of receptor tyrosine kinase activity. Receptor autophosphorylation creates binding sites for SH2-containing and phosphotyrosine-binding proteins. KIT also phosphorylates substrate proteins that are recruited to the signaling complex. Many signaling molecules have been identified as binding partners for specific phosphotyrosine residues on activated KIT. These include the p85 subunit of phosphatidylinositol 3’ kinase (PI3K), phospholipase Cγ, and the Grb2 and Grb7 adaptors [reviewed in (7)].

 

The complete absence of KIT kinase activity leads to death in utero or perinatally (8), but mice with loss-of-function mutations in KIT [for example in the Kit viable dominant spotting allele, Wv(1)] are viable, having variable defects in hematopoiesis, fertility and pigmentation (9). The severity of the mutant phenotype generally correlates with the level of KIT tyrosine kinase activity.

 

In humans, loss-of-function mutations in KIT result in piebaldism (10) (OMIM #172800), an autosomal dominant disease characterized by a white forelock and large, non-pigmented patches on the forehead, eyebrows, chin, chest, abdomen and extremities. Interestingly, no hematopoietic defects have been reported in humans with KIT mutations. Activating mutations in KIT are implicated in several cancers, including gastrointestinal stromal tumors (11), mastocytosis (12), and germ cell tumors (13).

 

The mooyah2 mutation (I881N) likely prevents proper activation of KIT kinase activity. The mutation may both disrupt catalytic loop structure or orientation, as well as prevent the activation loop from adopting an open conformation induced by ligand binding.

Primers PCR Primer
Mooyah2(F):5'- TTCAGCTGCGTGTACACATTTG -3'
Mooyah2(R):5'- CACAGCCATGACATTTGAGCG -3'

Sequencing Primer
Mooyah2_seq(F):5'- CACATTTGAAAGTGATGTCTGGTCC -3'
Mooyah2_seq(R):5'- CATGACATTTGAGCGCGGGTG -3'
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 401 nucleotides is amplified (chromosome 5, + strand):


1   ttcagctgcg tgtacacatt tgaaagtgat gtctggtcct atgggatttt cctctgggag
61  ctcttctcct taggtaaaat gttccttacc caagatgccc tcactgtcta aaagcttctg
121 tcgtctcccg cccacatgga cactgatttg ccacctctct gcacccagga agcagcccct
181 acccagggat gccggtcgac tccaagttct acaagatgat caaggaaggc ttccggatgg
241 tcagcccgga gcacgcgcct gccgaaatgt aaggactcac aagccttttc ttctgataat
301 gtccttttga aagacagaaa tgttgacagt ctttgctagc agggtttgaa atgtcactca
361 cttggttctt gggccacccg cgctcaaatg tcatggctgt g


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsAndon Arnold, Lauren Prince, Brittney Roy, Jamie Russell, and Bruce Beutler