Mutagenetix > Incidental Mutation

Incidental Mutation 'R6155:Taf4'

489502

Institutional Source

Beutler Lab

Gene Symbol

Taf4

Ensembl Gene

ENSMUSG00000039117

Gene Name

TATA-box binding protein associated factor 4

Synonyms

TAFII130, Taf2c1, TAFII135, Taf4a

MMRRC Submission

044302-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6155 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

179553945-179618439 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 179555317 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1015 (V1015A)

Ref Sequence

ENSEMBL: ENSMUSP00000038610 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041618] [ENSMUST00000227325]

AlphaFold

E9QAP7

Predicted Effect

probably damaging
Transcript: ENSMUST00000041618
AA Change: V1015A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038610
Gene: ENSMUSG00000039117
AA Change: V1015A

Domain	Start	End	E-Value	Type
low complexity region	28	44	N/A	INTRINSIC
low complexity region	64	181	N/A	INTRINSIC
SCOP:d1hqva_	312	325	6e-3	SMART
low complexity region	339	371	N/A	INTRINSIC
low complexity region	395	408	N/A	INTRINSIC
low complexity region	428	443	N/A	INTRINSIC
low complexity region	445	458	N/A	INTRINSIC
internal_repeat_1	465	500	2.85e-5	PROSPERO
low complexity region	537	547	N/A	INTRINSIC
TAFH	550	642	4.9e-54	SMART
internal_repeat_1	692	727	2.85e-5	PROSPERO
low complexity region	767	773	N/A	INTRINSIC
Pfam:TAF4	791	1039	3.5e-81	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000227325
AA Change: V1003A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

Meta Mutation Damage Score

0.5965

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that has been shown to potentiate transcriptional activation by retinoic acid, thyroid hormone and vitamin D3 receptors. In addition, this subunit interacts with the transcription factor CREB, which has a glutamine-rich activation domain, and binds to other proteins containing glutamine-rich regions. Aberrant binding to this subunit by proteins with expanded polyglutamine regions has been suggested as one of the pathogenetic mechanisms underlying a group of neurodegenerative disorders referred to as polyglutamine diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for deletions of this marker die embryonically sometime around E9.5. Conditional expression of this allele in the epidermis causes skin barrier defects and defects in hair growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg3	T	C	5: 105,111,510 (GRCm39)	Y319C	probably benign	Het
Actn4	A	C	7: 28,595,566 (GRCm39)	I763S	probably damaging	Het
Actr8	G	A	14: 29,700,546 (GRCm39)		probably null	Het
Adrb1	T	C	19: 56,711,336 (GRCm39)	L178P	probably damaging	Het
Afap1	A	G	5: 36,092,953 (GRCm39)	Y19C	unknown	Het
Ankrd36	A	G	11: 5,637,442 (GRCm39)	E1337G	probably benign	Het
Arl4a	A	C	12: 40,086,519 (GRCm39)	V76G	probably damaging	Het
Bmp1	A	T	14: 70,745,447 (GRCm39)	I246K	probably damaging	Het
Camk4	A	T	18: 33,072,500 (GRCm39)	T18S	unknown	Het
Cep152	T	C	2: 125,423,620 (GRCm39)	H927R	probably benign	Het
Clca3a2	A	G	3: 144,525,118 (GRCm39)	I38T	probably damaging	Het
Clec2g	A	C	6: 128,957,236 (GRCm39)	T54P	probably damaging	Het
Cox20	A	G	1: 178,149,362 (GRCm39)	E31G	possibly damaging	Het
Crispld1	T	A	1: 17,823,241 (GRCm39)	H407Q	probably benign	Het
Csmd1	T	C	8: 15,953,231 (GRCm39)	I3417V	probably benign	Het
Dhtkd1	A	C	2: 5,915,170 (GRCm39)	H700Q	probably null	Het
Dnah10	G	A	5: 124,847,663 (GRCm39)	V1516M	probably damaging	Het
Dnah10	A	G	5: 124,862,239 (GRCm39)	T2165A	probably damaging	Het
Dock2	C	G	11: 34,244,123 (GRCm39)	M1072I	probably benign	Het
F11	T	A	8: 45,705,119 (GRCm39)	T141S	probably damaging	Het
Gabra6	T	A	11: 42,207,350 (GRCm39)	I245F	probably damaging	Het
H2-T5	G	A	17: 36,478,399 (GRCm39)	A211V	possibly damaging	Het
Herc1	T	A	9: 66,340,705 (GRCm39)	C1685S	possibly damaging	Het
Iftap	A	T	2: 101,406,355 (GRCm39)		probably null	Het
Il20	G	T	1: 130,838,477 (GRCm39)	D73E	probably damaging	Het
Ireb2	C	A	9: 54,793,811 (GRCm39)	P247Q	probably damaging	Het
Kcng3	T	C	17: 83,895,807 (GRCm39)	I220V	probably benign	Het
Lce1j	T	G	3: 92,696,379 (GRCm39)	Q133P	unknown	Het
Lgals9	C	T	11: 78,854,331 (GRCm39)	A287T	probably benign	Het
Lrrc52	A	G	1: 167,294,296 (GRCm39)		probably benign	Het
Map3k5	A	T	10: 19,994,187 (GRCm39)	H1027L	probably benign	Het
Morc3	A	G	16: 93,659,313 (GRCm39)	D407G	possibly damaging	Het
Myom1	T	C	17: 71,415,690 (GRCm39)		probably null	Het
Ncapg2	T	C	12: 116,401,631 (GRCm39)	F673S	possibly damaging	Het
Ncoa6	T	C	2: 155,249,368 (GRCm39)	D1312G	probably damaging	Het
Nkx1-1	A	T	5: 33,588,395 (GRCm39)	F298I	probably damaging	Het
Npas2	G	A	1: 39,326,557 (GRCm39)	R14Q	probably damaging	Het
Npas4	C	T	19: 5,036,898 (GRCm39)	C422Y	probably damaging	Het
Or11h4	T	C	14: 50,974,076 (GRCm39)	D181G	probably benign	Het
Or2y11	T	A	11: 49,443,411 (GRCm39)	I279N	possibly damaging	Het
Or4c123	A	G	2: 89,126,765 (GRCm39)	L283S	probably damaging	Het
Or5p4	T	C	7: 107,680,493 (GRCm39)	V164A	probably benign	Het
Pcdhga4	T	C	18: 37,819,546 (GRCm39)	I365T	probably damaging	Het
Pear1	T	A	3: 87,666,875 (GRCm39)	T37S	probably damaging	Het
Pkn2	A	T	3: 142,559,454 (GRCm39)	F24I	probably benign	Het
Plcb3	G	A	19: 6,943,533 (GRCm39)	A122V	probably damaging	Het
Pnliprp1	T	C	19: 58,718,565 (GRCm39)		probably null	Het
Pramel28	T	A	4: 143,691,712 (GRCm39)	H337L	probably benign	Het
Psmb3	T	A	11: 97,603,278 (GRCm39)	F164I	probably damaging	Het
Ptch2	T	A	4: 116,954,105 (GRCm39)	F45Y	probably damaging	Het
Ptpn23	C	A	9: 110,216,849 (GRCm39)		probably benign	Het
Pusl1	A	G	4: 155,975,005 (GRCm39)	S199P	probably damaging	Het
Rasgrp2	C	A	19: 6,452,531 (GRCm39)	L35I	probably damaging	Het
Rictor	T	C	15: 6,823,458 (GRCm39)	L1545P	probably benign	Het
Rtn4r	A	T	16: 17,969,258 (GRCm39)	M229L	probably benign	Het
Ruvbl1	A	T	6: 88,456,107 (GRCm39)		probably null	Het
Slc35b3	A	T	13: 39,128,572 (GRCm39)	S30T	probably damaging	Het
Sorcs3	T	C	19: 48,387,136 (GRCm39)	V207A	possibly damaging	Het
Sox13	A	G	1: 133,321,005 (GRCm39)	S2P	probably damaging	Het
Sptbn1	A	C	11: 30,087,403 (GRCm39)	L999R	probably damaging	Het
Top3b	T	C	16: 16,709,373 (GRCm39)	L687P	probably damaging	Het
Tpp2	T	A	1: 43,995,649 (GRCm39)	V268E	probably damaging	Het
Ttc6	T	C	12: 57,784,402 (GRCm39)	Y1824H	possibly damaging	Het
Txk	A	G	5: 72,858,069 (GRCm39)	Y360H	probably damaging	Het
Vmn2r57	T	C	7: 41,078,114 (GRCm39)	I115V	probably benign	Het
Vmn2r98	T	C	17: 19,286,143 (GRCm39)	S214P	possibly damaging	Het
Zbtb48	T	C	4: 152,106,495 (GRCm39)		probably null	Het
Zzz3	A	G	3: 152,133,319 (GRCm39)	I126V	possibly damaging	Het

Other mutations in Taf4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Taf4	APN	2	179,618,418 (GRCm39)	missense	unknown
IGL00517:Taf4	APN	2	179,566,206 (GRCm39)	splice site	probably benign
IGL02159:Taf4	APN	2	179,580,263 (GRCm39)	missense	probably benign	0.24
IGL02254:Taf4	APN	2	179,562,977 (GRCm39)	missense	probably benign	0.25
IGL03366:Taf4	APN	2	179,576,847 (GRCm39)	missense	probably damaging	1.00
R0049:Taf4	UTSW	2	179,565,884 (GRCm39)	missense	probably damaging	0.98
R0049:Taf4	UTSW	2	179,565,884 (GRCm39)	missense	probably damaging	0.98
R1267:Taf4	UTSW	2	179,571,117 (GRCm39)	missense	possibly damaging	0.46
R1495:Taf4	UTSW	2	179,574,820 (GRCm39)	missense	probably damaging	1.00
R1560:Taf4	UTSW	2	179,577,746 (GRCm39)	missense	probably benign	0.14
R1756:Taf4	UTSW	2	179,618,324 (GRCm39)	missense	unknown
R1893:Taf4	UTSW	2	179,574,823 (GRCm39)	missense	probably damaging	0.98
R1932:Taf4	UTSW	2	179,573,822 (GRCm39)	missense	probably damaging	1.00
R2213:Taf4	UTSW	2	179,577,683 (GRCm39)	critical splice donor site	probably null
R3896:Taf4	UTSW	2	179,573,807 (GRCm39)	missense	probably benign	0.45
R4050:Taf4	UTSW	2	179,573,805 (GRCm39)	missense	probably damaging	1.00
R4448:Taf4	UTSW	2	179,577,764 (GRCm39)	missense	possibly damaging	0.65
R4736:Taf4	UTSW	2	179,566,287 (GRCm39)	missense	probably damaging	1.00
R5124:Taf4	UTSW	2	179,573,822 (GRCm39)	missense	probably damaging	1.00
R6238:Taf4	UTSW	2	179,573,832 (GRCm39)	missense	probably damaging	0.97
R6292:Taf4	UTSW	2	179,565,780 (GRCm39)	missense	probably damaging	1.00
R7749:Taf4	UTSW	2	179,573,822 (GRCm39)	missense	probably damaging	1.00
R7751:Taf4	UTSW	2	179,573,822 (GRCm39)	missense	probably damaging	1.00
R7752:Taf4	UTSW	2	179,573,822 (GRCm39)	missense	probably damaging	1.00
R7754:Taf4	UTSW	2	179,573,822 (GRCm39)	missense	probably damaging	1.00
R7835:Taf4	UTSW	2	179,573,822 (GRCm39)	missense	probably damaging	1.00
R7879:Taf4	UTSW	2	179,573,822 (GRCm39)	missense	probably damaging	1.00
R7880:Taf4	UTSW	2	179,577,726 (GRCm39)	nonsense	probably null
R7880:Taf4	UTSW	2	179,573,822 (GRCm39)	missense	probably damaging	1.00
R7883:Taf4	UTSW	2	179,571,088 (GRCm39)	missense	probably damaging	1.00
R7899:Taf4	UTSW	2	179,573,822 (GRCm39)	missense	probably damaging	1.00
R7902:Taf4	UTSW	2	179,573,822 (GRCm39)	missense	probably damaging	1.00
R7905:Taf4	UTSW	2	179,573,822 (GRCm39)	missense	probably damaging	1.00
R9743:Taf4	UTSW	2	179,581,592 (GRCm39)	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- AACTGCTCCATTGTAAAGAGGTG -3'
(R):5'- AGGGTGTTTCCTCAAAACCAG -3'

Sequencing Primer
(F):5'- TGTAAAGAGGTGGCTGTTTTTAAAC -3'
(R):5'- CTCAAAACCAGGGTCTTTGGGATAC -3'

Posted On

2017-10-10