Mutagenetix > Incidental Mutation

Incidental Mutation 'R3005:Cnga1'

257411

Institutional Source

Beutler Lab

Gene Symbol

Cnga1

Ensembl Gene

ENSMUSG00000067220

Gene Name

cyclic nucleotide gated channel alpha 1

Synonyms

Cncg

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.310) question?

Stock #

R3005 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

72761039-72800095 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 72762450 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 355 (I355F)

Ref Sequence

ENSEMBL: ENSMUSP00000143881 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087213] [ENSMUST00000169997] [ENSMUST00000201463]

AlphaFold

P29974

Predicted Effect

probably damaging
Transcript: ENSMUST00000087213
AA Change: I355F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084464
Gene: ENSMUSG00000067220
AA Change: I355F

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	156	400	3e-33	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000169997
AA Change: I355F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132329
Gene: ENSMUSG00000067220
AA Change: I355F

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	194	388	4.7e-19	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000201463
AA Change: I355F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143881
Gene: ENSMUSG00000067220
AA Change: I355F

Domain	Start	End	E-Value	Type
coiled coil region	111	150	N/A	INTRINSIC
Pfam:Ion_trans	156	400	3e-33	PFAM
cNMP	471	595	3.31e-25	SMART
PDB:3SWF\|C	615	684	6e-31	PDB

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in phototransduction. Along with another protein, the encoded protein forms a cGMP-gated cation channel in the plasma membrane, allowing depolarization of rod photoreceptors. This represents the last step in the phototransduction pathway. Defects in this gene are a cause of retinitis pigmentosa autosomal recessive (ARRP) disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cep162	C	A	9: 87,114,113 (GRCm39)	V320L	probably benign	Het
Csnk1e	T	C	15: 79,323,005 (GRCm39)	I15V	probably benign	Het
Dele1	T	A	18: 38,393,012 (GRCm39)	N405K	possibly damaging	Het
Exosc8	T	C	3: 54,639,568 (GRCm39)		probably null	Het
Garre1	T	C	7: 33,984,209 (GRCm39)	E138G	probably damaging	Het
Gstm3	G	T	3: 107,874,923 (GRCm39)	Q110K	probably benign	Het
Hace1	G	A	10: 45,524,959 (GRCm39)	G242R	probably damaging	Het
Lcn6	T	A	2: 25,567,261 (GRCm39)		probably null	Het
Msh6	A	G	17: 88,295,713 (GRCm39)	E1088G	probably benign	Het
Nlrp4c	G	A	7: 6,068,524 (GRCm39)	V142M	probably benign	Het
Nup50	G	A	15: 84,813,661 (GRCm39)		probably null	Het
Or51g2	C	T	7: 102,622,465 (GRCm39)	V245I	possibly damaging	Het
Ppp2r5a	A	T	1: 191,091,173 (GRCm39)	F218Y	probably damaging	Het
Ptov1	T	C	7: 44,513,886 (GRCm39)	N52S	probably damaging	Het
Rif1	G	A	2: 51,972,776 (GRCm39)	A303T	probably damaging	Het
Ror1	T	A	4: 100,298,961 (GRCm39)	V778E	probably damaging	Het
Tcaf3	A	T	6: 42,570,978 (GRCm39)	L258H	probably damaging	Het
Utp20	C	A	10: 88,613,317 (GRCm39)	K1321N	probably damaging	Het
Vmn2r54	T	A	7: 12,349,221 (GRCm39)	Q787L	probably benign	Het

Other mutations in Cnga1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02332:Cnga1	APN	5	72,761,829 (GRCm39)	missense	probably damaging	1.00
IGL02345:Cnga1	APN	5	72,762,615 (GRCm39)	missense	probably benign	0.00
IGL02354:Cnga1	APN	5	72,774,061 (GRCm39)	splice site	probably null
IGL02361:Cnga1	APN	5	72,774,061 (GRCm39)	splice site	probably null
IGL03025:Cnga1	APN	5	72,762,756 (GRCm39)	missense	probably benign
IGL03257:Cnga1	APN	5	72,768,205 (GRCm39)	missense	probably damaging	1.00
tintoretto	UTSW	5	72,766,843 (GRCm39)	missense	probably damaging	1.00
IGL03046:Cnga1	UTSW	5	72,761,681 (GRCm39)	missense	probably benign	0.01
R0238:Cnga1	UTSW	5	72,762,374 (GRCm39)	missense	probably damaging	0.97
R0238:Cnga1	UTSW	5	72,762,374 (GRCm39)	missense	probably damaging	0.97
R0352:Cnga1	UTSW	5	72,761,846 (GRCm39)	missense	possibly damaging	0.95
R1292:Cnga1	UTSW	5	72,762,026 (GRCm39)	missense	probably damaging	1.00
R1386:Cnga1	UTSW	5	72,769,526 (GRCm39)	nonsense	probably null
R1903:Cnga1	UTSW	5	72,774,068 (GRCm39)	missense	possibly damaging	0.94
R2096:Cnga1	UTSW	5	72,776,404 (GRCm39)	missense	possibly damaging	0.85
R2097:Cnga1	UTSW	5	72,776,404 (GRCm39)	missense	possibly damaging	0.85
R2101:Cnga1	UTSW	5	72,776,404 (GRCm39)	missense	possibly damaging	0.85
R2276:Cnga1	UTSW	5	72,776,404 (GRCm39)	missense	possibly damaging	0.85
R2279:Cnga1	UTSW	5	72,776,404 (GRCm39)	missense	possibly damaging	0.85
R2507:Cnga1	UTSW	5	72,776,404 (GRCm39)	missense	possibly damaging	0.85
R2508:Cnga1	UTSW	5	72,776,404 (GRCm39)	missense	possibly damaging	0.85
R3779:Cnga1	UTSW	5	72,762,126 (GRCm39)	missense	probably damaging	1.00
R4357:Cnga1	UTSW	5	72,775,595 (GRCm39)	missense	probably damaging	1.00
R4399:Cnga1	UTSW	5	72,761,724 (GRCm39)	missense	probably damaging	0.98
R4615:Cnga1	UTSW	5	72,762,117 (GRCm39)	missense	probably damaging	1.00
R4946:Cnga1	UTSW	5	72,762,107 (GRCm39)	missense	probably damaging	1.00
R5229:Cnga1	UTSW	5	72,766,843 (GRCm39)	missense	probably damaging	1.00
R5474:Cnga1	UTSW	5	72,762,536 (GRCm39)	missense	probably damaging	1.00
R5566:Cnga1	UTSW	5	72,775,593 (GRCm39)	missense	probably damaging	0.98
R5754:Cnga1	UTSW	5	72,762,615 (GRCm39)	missense	probably benign	0.00
R5899:Cnga1	UTSW	5	72,776,404 (GRCm39)	missense	possibly damaging	0.85
R5906:Cnga1	UTSW	5	72,768,201 (GRCm39)	missense	probably benign	0.19
R5954:Cnga1	UTSW	5	72,762,221 (GRCm39)	missense	probably damaging	0.99
R5997:Cnga1	UTSW	5	72,761,918 (GRCm39)	missense	probably damaging	0.98
R6087:Cnga1	UTSW	5	72,768,155 (GRCm39)	missense	probably damaging	1.00
R6365:Cnga1	UTSW	5	72,762,288 (GRCm39)	missense	probably benign	0.00
R6391:Cnga1	UTSW	5	72,769,702 (GRCm39)	critical splice donor site	probably null
R6525:Cnga1	UTSW	5	72,775,574 (GRCm39)	missense	probably damaging	1.00
R7046:Cnga1	UTSW	5	72,786,696 (GRCm39)	intron	probably benign
R7229:Cnga1	UTSW	5	72,775,592 (GRCm39)	missense	probably benign
R7299:Cnga1	UTSW	5	72,762,775 (GRCm39)	missense	probably benign	0.20
R7367:Cnga1	UTSW	5	72,762,701 (GRCm39)	missense	possibly damaging	0.75
R7425:Cnga1	UTSW	5	72,766,868 (GRCm39)	missense	probably benign	0.12
R7449:Cnga1	UTSW	5	72,762,647 (GRCm39)	missense	probably benign	0.29
R7538:Cnga1	UTSW	5	72,769,723 (GRCm39)	missense	probably benign	0.24
R7808:Cnga1	UTSW	5	72,761,616 (GRCm39)	missense	possibly damaging	0.69
R7922:Cnga1	UTSW	5	72,762,225 (GRCm39)	missense	possibly damaging	0.81
R7938:Cnga1	UTSW	5	72,761,597 (GRCm39)	missense	probably benign	0.27
R7994:Cnga1	UTSW	5	72,762,003 (GRCm39)	missense	probably damaging	1.00
R8249:Cnga1	UTSW	5	72,762,737 (GRCm39)	missense	probably benign	0.02
R8690:Cnga1	UTSW	5	72,761,835 (GRCm39)	missense	probably benign	0.15
R9689:Cnga1	UTSW	5	72,762,170 (GRCm39)	missense	probably benign	0.10
X0062:Cnga1	UTSW	5	72,761,828 (GRCm39)	missense	probably damaging	1.00
Z1177:Cnga1	UTSW	5	72,762,873 (GRCm39)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGGTCCACAGGTAGTCAAAC -3'
(R):5'- TCGTCATCATCATCCACTGG -3'

Sequencing Primer
(F):5'- GGTAGTCAAACCATTTAATAACCCTC -3'
(R):5'- ATCCACTGGAACGCTTGTG -3'

Posted On

2015-01-11