Phenotypic Mutation 'primurus' (pdf version)
Alleleprimurus
Mutation Type missense
Chromosome19
Coordinate25,183,609 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Dock8
Gene Name dedicator of cytokinesis 8
Synonym(s) A130095G14Rik, 5830472H07Rik, 1200017A24Rik
Chromosomal Location 24,999,529-25,202,432 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_033374; Ensembl: ENSMUST00000025831; MGI: 2149010

Mapped Yes 
Amino Acid Change Serine changed to Proline
Institutional SourceAustralian Phenomics Network
Gene Model not available
PDB Structure
Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: S1827P

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000025831)
Meta Mutation Damage Score Not available question?
Is this an essential gene? Probably nonessential (E-score: 0.095) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B cells - decreased
FACS CD4+ T cells - decreased
FACS CD8+ T cells - decreased
immune system
Candidate Explorer Status CE: no linkage results
Single pedigree
Linkage Analysis Data
Penetrance 100% 
Alleles Listed at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25127711 critical splice donor site probably benign
IGL00737:Dock8 APN 19 25182976 missense probably benign 0.00
IGL00755:Dock8 APN 19 25051509 missense probably benign 0.09
IGL00822:Dock8 APN 19 25188409 nonsense probably null
IGL00838:Dock8 APN 19 25175459 nonsense probably null
IGL01419:Dock8 APN 19 25119452 missense probably benign 0.08
IGL01456:Dock8 APN 19 25119499 missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25169441 missense probably damaging 0.99
IGL01602:Dock8 APN 19 25089888 splice site probably benign
IGL01605:Dock8 APN 19 25089888 splice site probably benign
IGL01753:Dock8 APN 19 25061292 splice site probably benign
IGL01843:Dock8 APN 19 25089928 missense probably benign 0.02
IGL02032:Dock8 APN 19 25130405 missense probably damaging 0.99
IGL02073:Dock8 APN 19 25200986 critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25078205 critical splice donor site probably null
IGL02402:Dock8 APN 19 25078145 missense probably benign 0.25
IGL02529:Dock8 APN 19 25100926 nonsense probably null
IGL02728:Dock8 APN 19 25132220 missense probably benign
IGL02739:Dock8 APN 19 25188488 missense probably damaging 1.00
IGL03037:Dock8 APN 19 25086181 missense probably benign 0.02
IGL03104:Dock8 APN 19 25201020 nonsense probably null
IGL03137:Dock8 APN 19 25155948 missense probably benign 0.19
IGL03365:Dock8 APN 19 25099684 missense possibly damaging 0.70
Defenseless UTSW 19 25051563 missense probably benign 0.00
Guardate UTSW 19 25149831 missense probably benign
Pap UTSW 19 25122441 missense probably benign 0.31
snowdrop UTSW 19 25184941 critical splice donor site probably null
warts_and_all UTSW 19 25169501 critical splice donor site probably null
R0021:Dock8 UTSW 19 25163047 missense probably benign 0.01
R0147:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0148:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0294:Dock8 UTSW 19 25188350 missense probably damaging 1.00
R0537:Dock8 UTSW 19 25171577 missense probably benign 0.08
R0630:Dock8 UTSW 19 25061160 missense probably benign 0.10
R1163:Dock8 UTSW 19 25051503 missense probably benign
R1164:Dock8 UTSW 19 25090027 missense probably benign 0.44
R1471:Dock8 UTSW 19 25201036 missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25051563 missense probably benign 0.00
R1803:Dock8 UTSW 19 25132235 missense probably benign 0.00
R1822:Dock8 UTSW 19 25161058 missense probably benign 0.31
R1852:Dock8 UTSW 19 25127128 missense probably benign 0.45
R1916:Dock8 UTSW 19 25061157 missense probably benign 0.02
R1984:Dock8 UTSW 19 25121181 missense probably null 0.95
R2311:Dock8 UTSW 19 25183004 missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25200393 missense probably damaging 0.99
R2483:Dock8 UTSW 19 25079877 missense probably benign
R3116:Dock8 UTSW 19 25188494 missense probably benign 0.00
R3157:Dock8 UTSW 19 25149831 missense probably benign
R3623:Dock8 UTSW 19 25079877 missense probably benign
R3624:Dock8 UTSW 19 25079877 missense probably benign
R3800:Dock8 UTSW 19 25164352 missense probably benign 0.08
R3844:Dock8 UTSW 19 25065430 nonsense probably null
R3895:Dock8 UTSW 19 25051501 missense probably benign 0.31
R3901:Dock8 UTSW 19 25100905 missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25184941 critical splice donor site probably null
R4428:Dock8 UTSW 19 25200499 missense probably damaging 0.98
R4428:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4429:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4431:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4545:Dock8 UTSW 19 25188358 missense probably damaging 1.00
R4839:Dock8 UTSW 19 25169494 missense probably benign 0.00
R4897:Dock8 UTSW 19 25181637 missense probably benign 0.00
R4939:Dock8 UTSW 19 25122400 missense probably damaging 1.00
R4995:Dock8 UTSW 19 25158383 missense probably benign 0.02
R5035:Dock8 UTSW 19 25086207 missense probably damaging 0.99
R5294:Dock8 UTSW 19 25061153 missense probably benign 0.01
R5324:Dock8 UTSW 19 25163094 missense probably benign 0.17
R5478:Dock8 UTSW 19 25079822 missense probably benign
R5704:Dock8 UTSW 19 25174222 missense probably damaging 1.00
R5724:Dock8 UTSW 19 25122421 missense probably damaging 1.00
R5745:Dock8 UTSW 19 25130397 missense probably benign 0.02
R5864:Dock8 UTSW 19 25061220 missense probably damaging 0.99
R5870:Dock8 UTSW 19 25132126 missense probably benign
R5893:Dock8 UTSW 19 25122447 missense probably damaging 1.00
R5954:Dock8 UTSW 19 25171619 missense probably damaging 1.00
R6087:Dock8 UTSW 19 25161074 missense probably benign 0.00
R6223:Dock8 UTSW 19 25161052 missense probably benign 0.00
R6391:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25127484 missense probably damaging 0.99
R6786:Dock8 UTSW 19 25183022 missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25122441 missense probably benign 0.31
R6818:Dock8 UTSW 19 25169501 critical splice donor site probably null
R6885:Dock8 UTSW 19 25147378 missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25188382 missense probably damaging 1.00
R6923:Dock8 UTSW 19 25095606 missense probably benign
R7001:Dock8 UTSW 19 25099677 missense probably benign
R7141:Dock8 UTSW 19 25181620 missense probably null 0.75
R7203:Dock8 UTSW 19 25181563 missense probably damaging 1.00
R7257:Dock8 UTSW 19 25127085 missense probably benign 0.08
R7296:Dock8 UTSW 19 25184881 missense probably benign 0.00
X0027:Dock8 UTSW 19 25161129 missense probably benign
Mode of Inheritance Autosomal Recessive
Local Stock None
Repository

Australian PhenomeBank: 4498

Last Updated 2019-05-26 8:06 AM by Diantha La Vine
Record Created 2011-01-12 2:36 PM by Nora G. Smart
Record Posted 2011-01-12
Phenotypic Description

The primurus mutation was identified while screening N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice for a failure to mount long-lived, high-affinity antibody responses despite a relatively normal initial wave of antibody production.  Primurus is allelic to captain morgan.

 

For more information on the phenotype of primurus mice, please see the record for captain morgan.

Nature of Mutation

The primurus mutation was mapped to Chromosome 19.  Sequencing B cell–expressed transcripts in the minimal 4.5 Mb interval identified a T to C transition at position 5601 of the Dock8 transcript using Genbank record NM_028785.3, in exon 43 of 48 total exons.

 

5586 AAGCTCCCGGAGATCTCACATAGACTAGAGGGA
1822 -K--L--P--E--I--S--H--R--L--E--G-

 

The mutated nucleotide is indicated in red lettering and causes a serine to proline change at amino acid 1827 of the encoded protein.

Protein Prediction
Figure 1. Domain structure of DOCK8, a member of the DOCKC subfamily. DHR-1 domain shares a weak homology to the C2 domain. The large DHR-2 domain interacts with the nucleotide-free form of Rac and/or Cdc42. The primurus mutation causes a serine to proline change at amino acid 1827 of the encoded protein. This image is interactive. Other mutations found in DOCK8 are noted in red. Click on each mutation for more specific information.

The primurus mutation alters a highly conserved amino acid in the DHR-2 domain (Figure 1).  In the structure of DOCK9 in complex with Cdc42 (1), this conserved serine lies in the DHR-2 lobe B α-helix 6, which forms part of the Cdc42-binding site and provides four Cdc42 contact residues.  The pri substitution of Ser1827 to Pro1827 would be expected to break this α-helical structure and interfere with the guanine-exchange factor activity of the DHR-2 domain.

Putative Mechanism

The phenotypes of primurus animals are identical to those found in captain morgan mice, suggesting that primurus is a strong loss of function allele.  

For more information on Dock8, please see the record for captain morgan.

Primers Primers cannot be located by automatic search.
Genotyping

Genotyping protocols are from the Australian PhenomeBank. 

Primurus

References

1. Yang, J., Zhang, Z., Roe, S. M., Marshall, C. J., and Barford, D. (2009) Activation of Rho GTPases by DOCK Exchange Factors is Mediated by a Nucleotide Sensor. Science. 325, 1398-1402.

Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsKatrina L Randall, Teresa Lambe, Andy L Johnson, Bebhinn Treanor, Edyta Kucharska, Heather Domaschenz, Belinda Whittle, Lina E Tze, Anselm Enders, Tanya L Crockford, Tiphaine Bouriez-Jones, Duncan Alston, Jason G Cyster, Michael J Lenardo, Fabienne Mackay, Elissa K Deenick, Stuart G Tangye, Tyani D Chan, Tahra Camidge, Robert Brink, Carola G Vinuesa, Facundo D Batista, Richard J Cornall, Christopher C Goodnow
Edit History
2011-05-25 10:55 AM (current)
2011-01-14 11:51 AM
2011-01-13 10:11 AM
2011-01-13 10:11 AM
2011-01-12 5:12 PM
2011-01-12 3:33 PM
2011-01-12 3:27 PM