Phenotypic Mutation 'tilcara' (pdf version)
Alleletilcara
Mutation Type missense
Chromosome7
Coordinate122,595,005 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Prkcb
Gene Name protein kinase C, beta
Synonym(s) Pkcb, Prkcb2, Prkcb1, A130082F03Rik, PKC-Beta
Chromosomal Location 122,288,751-122,634,402 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired humoral immune responses, altered proliferative responses of B cells to various stimuli, abnormal vascular wound healing, and deficits in contextual and cued fear conditioning. ENU-induced mutations leadto impaired T cell-independent IgM responses. [provided by MGI curators]
Accession Number
NCBI RefSeq: NM_008855; MGI: 97596
Mapped Yes 
Amino Acid Change Serine changed to Proline
Institutional SourceAustralian Phenomics Network
Gene Model not available
SMART Domains Protein: ENSMUSP00000064812
Gene: ENSMUSG00000052889
AA Change: S552P

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 664 9.86e-27 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
(Using ENSMUST00000064921)
SMART Domains Protein: ENSMUSP00000070019
Gene: ENSMUSG00000052889
AA Change: S552P

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
(Using ENSMUST00000064989)
SMART Domains Protein: ENSMUSP00000138788
Gene: ENSMUSG00000052889
AA Change: S552P

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
(Using ENSMUST00000143692)
Meta Mutation Damage Score Not available question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
immune system
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
Candidate Explorer Status CE: no linkage results
Single pedigree
Linkage Analysis Data
Penetrance 100% 
Alleles Listed at MGI

All alleles(3) : Targeted, other(2) Chemically induced(1)  

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Prkcb APN 7 122590167 missense probably damaging 1.00
IGL02273:Prkcb APN 7 122627767 missense probably damaging 1.00
IGL02638:Prkcb APN 7 122600840 splice site probably benign
IGL02962:Prkcb APN 7 122425047 splice site probably null
IGL03013:Prkcb APN 7 122627682 missense probably damaging 1.00
IGL03224:Prkcb APN 7 122516924 nonsense probably null
Almonde UTSW 7 122582449 missense probably damaging 1.00
Baghdad UTSW 7 122627663 missense probably benign 0.07
Mesopotamia UTSW 7 122289514 missense probably damaging 1.00
tigris UTSW 7 122424977 missense probably damaging 1.00
Tikrit UTSW 7 122627693 missense probably damaging 1.00
untied UTSW 7 122582439 missense possibly damaging 0.90
F5770:Prkcb UTSW 7 122528476 missense probably damaging 0.99
R0078:Prkcb UTSW 7 122590170 missense probably damaging 1.00
R0409:Prkcb UTSW 7 122424977 missense probably damaging 1.00
R0660:Prkcb UTSW 7 122424959 missense possibly damaging 0.56
R1462:Prkcb UTSW 7 122582449 missense probably damaging 1.00
R1462:Prkcb UTSW 7 122582449 missense probably damaging 1.00
R1480:Prkcb UTSW 7 122594642 missense probably damaging 1.00
R1518:Prkcb UTSW 7 122544631 critical splice acceptor site probably null
R1540:Prkcb UTSW 7 122627693 missense probably damaging 1.00
R1860:Prkcb UTSW 7 122568201 missense probably damaging 1.00
R3110:Prkcb UTSW 7 122516856 missense probably damaging 0.99
R3112:Prkcb UTSW 7 122516856 missense probably damaging 0.99
R4583:Prkcb UTSW 7 122457224 missense probably benign 0.32
R4847:Prkcb UTSW 7 122568149 missense probably benign 0.35
R5220:Prkcb UTSW 7 122289455 missense probably damaging 1.00
R5487:Prkcb UTSW 7 122600725 nonsense probably null
R5599:Prkcb UTSW 7 122582478 missense probably benign 0.17
R5946:Prkcb UTSW 7 122544703 missense probably benign
R6257:Prkcb UTSW 7 122568163 missense probably benign
R6590:Prkcb UTSW 7 122289514 missense probably damaging 1.00
R6618:Prkcb UTSW 7 122627663 missense probably benign 0.07
R6690:Prkcb UTSW 7 122289514 missense probably damaging 1.00
R6763:Prkcb UTSW 7 122594664 missense probably damaging 1.00
R7289:Prkcb UTSW 7 122544687 missense probably benign 0.04
V7581:Prkcb UTSW 7 122528476 missense probably damaging 0.99
X0061:Prkcb UTSW 7 122457306 missense probably benign 0.03
Mode of Inheritance Autosomal Semidominant
Local Stock None
Repository

Australian Phenomics Bank: 2369

Last Updated 2019-05-17 7:57 AM by Diantha La Vine
Record Created 2010-10-14 2:27 PM by Nora G. Smart
Record Posted 2010-10-14
Phenotypic Description

Tilcara was identified in a forward genetic screen for mutations that impair the T cell-independent immunologic (Ig)M response to the model antigen 2,4,6-trinitrophenyl (TNP)-Ficoll. The Tilcara phenotype appears to be semidominant, with heterozygous animals displaying intermediate responses to TNP-Ficoll and homozygous animals displaying low responses relative to wild type controls.

Nature of Mutation

The Tilcara mutation was mapped to Chromosome 7, and corresponds to a T to C transition at position 1874 of the Prkcb gene using Genbank record NM_008855, in exon 15 of 17 total exons.

 

1859 GATGAACTCTTCCAGTCAATCATGGAACACAAT

547  -D--E--L--F--Q--S--I--M--E--H--N-

 

The mutated nucleotide is indicated in red lettering, and results in a serine to proline substitution at amino acid 552 of the PKCβ protein.

Protein Prediction
Figure 1. Domain structure of conventional PKCs (amino acid numbering is for PKCβII). Key features of the regulatory domain include the pseudosubstrate motif (PS), the DAG-binding C1 domain, and the calcium-binding C2 domain. The kinase domain consists of the ATP-binding C3 domain, the substrate-binding domain and the V5 region. Key phosphorylation sites necessary for PKC activity are indicated in orange ovals. The residue altered by the Tilcara mutation is shown in red. C, conserved region; V, variable region. Other mutations found in PRKCB are noted in red. Click on each mututation for more specific information.

The Tilcara mutation results in the substitution of a serine for a proline at amino acid 552 located in the V5 region of the PKCβ kinase domain (Figure 1).  The amino acid is in the common region of V5.  

 

Please see the record for Untied for more information on Prkcb.

Putative Mechanism

The reduction of B cell antibody responses to TNP-Ficoll in Tilcara mice suggests that the function of B-1 and/or MZ B cells is impaired in these animals with BCR signaling likely affected.  These phenotypes are consistent with the phenotypes observed in Prkcb-/-animals, which also exhibit reduced T cell-independent antibody responses along with severe impairment of B-1 cells (1).  Mice heterozygous for the knockout allele have normal B cell numbers and B cell responses (1,2), which varies from the semidominant intermediate phenotype observed in Tilcara and Untied animals.  The semidominant phenotype observed in Tilcara mice may be due to the expression of nonfunctional, but appropriately localized, PKCβ proteins that are then able to inhibit the appropriate localization and function of wild type kinases.

 

The amino acid substitution in Tilcara mice occurs in V5 region of the kinase domain that contains the conserved turn and hydrophobic motifs.  Although Ser552 is not specifically implicated in catalytic function, the amino acid change at this location may affect kinase activity.

Primers Primers cannot be located by automatic search.
References
Science Writers Nora G. Smart
Illustrators Diantha La Vine
AuthorsEdyta Kucharska, Charis Teh, Belinda Whittle, Christopher C. Goodnow, Anselm Enders
Edit History
2011-05-27 12:21 PM (current)
2011-05-27 10:45 AM
2011-01-04 2:56 PM
2010-11-02 1:20 PM
2010-11-02 1:20 PM
2010-10-14 3:24 PM
2010-10-14 3:23 PM
2010-10-14 3:23 PM