Phenotypic Mutation 'Baby' (pdf version)
AlleleBaby
Mutation Type missense
Chromosome8
Coordinate22,675,036 bp (GRCm38)
Base Change T ⇒ G (forward strand)
Gene Ikbkb
Gene Name inhibitor of kappaB kinase beta
Synonym(s) IKK2, IKK[b], IKKbeta, IKK-beta, IKK-2
Chromosomal Location 22,659,212-22,706,589 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene phosphorylates the inhibitor in the inhibitor/NF-kappa-B complex, causing dissociation of the inhibitor and activation of NF-kappa-B. The encoded protein itself is found in a complex of proteins. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit liver degeneration and die in midgestation. Conditional mutations that lack gene expression in lymphoid cells or epidermal keratinocytes exhibit B and T cell deficits and skin inflammation, respectively. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_001159774NM_010546; MGI:1338071

Mapped Yes 
Amino Acid Change Isoleucine changed to Leucine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000033939] [ENSMUSP00000064235] [ENSMUSP00000138156] [ENSMUSP00000138378]
SMART Domains Protein: ENSMUSP00000033939
Gene: ENSMUSG00000031537
AA Change: I243L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 247 1.2e-38 PFAM
Pfam:Pkinase 15 296 1.2e-54 PFAM
Pfam:Kdo 31 176 1.3e-7 PFAM
IKKbetaNEMObind 705 742 4.71e-16 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
(Using ENSMUST00000033939)
SMART Domains Protein: ENSMUSP00000064235
Gene: ENSMUSG00000031537
AA Change: I243L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 247 7.3e-39 PFAM
Pfam:Pkinase 15 296 6.9e-56 PFAM
Pfam:Kdo 44 177 3e-8 PFAM
IKKbetaNEMObind 705 737 1.83e-4 SMART
Predicted Effect possibly damaging

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
(Using ENSMUST00000063401)
SMART Domains Protein: ENSMUSP00000138156
Gene: ENSMUSG00000031537
AA Change: I243L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 248 2.8e-38 PFAM
Pfam:Pkinase 15 296 2.5e-55 PFAM
Pfam:Kdo 43 177 1.4e-7 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
(Using ENSMUST00000125314)
SMART Domains Protein: ENSMUSP00000138378
Gene: ENSMUSG00000031537
AA Change: I243L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 15 248 2.8e-38 PFAM
Pfam:Pkinase 15 296 2.5e-55 PFAM
Pfam:Kdo 43 177 1.4e-7 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
(Using ENSMUST00000135326)
Meta Mutation Damage Score 0.408 question?
Is this an essential gene? Essential (E-score: 1.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS central memory CD4 T cells in CD4 T cells - decreased
MCMV susceptibility
post-MCMV FACS B1a cells in B1 cells - decreased
post-MCMV FACS B1b cells in B1 cells - increased
post-MCMV FACS CD44+ CD4 MFI - decreased
post-MCMV FACS CD44+ CD8 MFI - decreased
post-MCMV FACS CD44+ CD8 T cells - decreased
post-MCMV FACS CD44+ T MFI - decreased
post-MCMV FACS CD8a+ DCs (gated in CD11c+ cells) - increased
post-MCMV FACS effector memory CD4 T cells in CD4 T cells - decreased
post-MCMV FACS effector memory CD8 T cells in CD8 T cells - decreased
TLR signaling defect: hyposensitivity to MALP2
Candidate Explorer Status CE: not good candidate; human score: -1.5; ML prob: 0.154
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(19) : Chemically induced (ENU)(1) Gene trapped(2) Targeted(12) Transgenic(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Ikbkb APN 8 22706111 missense probably damaging 0.99
IGL00899:Ikbkb APN 8 22660447 missense possibly damaging 0.84
IGL02271:Ikbkb APN 8 22665903 missense probably benign 0.00
IGL02569:Ikbkb APN 8 22693883 missense probably damaging 1.00
IGL02610:Ikbkb APN 8 22675072 critical splice acceptor site probably null
IGL03085:Ikbkb APN 8 22682786 missense probably benign 0.03
Impaired UTSW 8 22666020 missense probably damaging 1.00
R0110:Ikbkb UTSW 8 22671635 nonsense probably null
R0366:Ikbkb UTSW 8 22695260 splice site probably benign
R0469:Ikbkb UTSW 8 22671635 nonsense probably null
R0510:Ikbkb UTSW 8 22671635 nonsense probably null
R1386:Ikbkb UTSW 8 22665617 missense possibly damaging 0.69
R1436:Ikbkb UTSW 8 22673403 missense probably benign 0.24
R1645:Ikbkb UTSW 8 22691066 missense probably damaging 0.98
R1695:Ikbkb UTSW 8 22673480 missense probably benign 0.00
R2118:Ikbkb UTSW 8 22667217 splice site probably benign
R2120:Ikbkb UTSW 8 22667217 splice site probably benign
R2121:Ikbkb UTSW 8 22667217 splice site probably benign
R2124:Ikbkb UTSW 8 22666020 missense probably damaging 1.00
R2124:Ikbkb UTSW 8 22667217 splice site probably benign
R2148:Ikbkb UTSW 8 22682745 missense probably damaging 1.00
R2179:Ikbkb UTSW 8 22681753 critical splice acceptor site probably null
R2897:Ikbkb UTSW 8 22669677 missense possibly damaging 0.71
R3861:Ikbkb UTSW 8 22678836 missense possibly damaging 0.94
R4019:Ikbkb UTSW 8 22671712 missense probably benign 0.03
R4723:Ikbkb UTSW 8 22669607 missense probably benign 0.24
R4962:Ikbkb UTSW 8 22681677 missense probably damaging 1.00
R5715:Ikbkb UTSW 8 22678850 missense probably damaging 1.00
R6738:Ikbkb UTSW 8 22675036 missense probably damaging 1.00
R6875:Ikbkb UTSW 8 22665893 missense probably damaging 0.99
R7054:Ikbkb UTSW 8 22671642 missense possibly damaging 0.95
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-05-14 11:49 AM by Anne Murray
Record Created 2019-04-04 7:59 AM by Bruce Beutler
Record Posted 2019-04-19
Phenotypic Description

Figure 1. Baby mice exhibit decreased frequencies of peripheral central memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Baby phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R6738, some of which showed reduced frequencies of central memory CD4 T cells in CD4 T cells in the peripheral blood (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced central memory CD4 T cell frequency using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 56 mutations (X-axis) identified in the G1 male of pedigree R6738. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 56 mutations. The reduced central memory CD4 T cell frequency phenotype was linked by continuous variable mapping to a mutation in Ikbkb:  an A to C transversion at base pair 22,675,036 (v38) on chromosome 8, or base pair 31,556 in the GenBank genomic region NC_000074. Linkage was found with a dominant model of inheritance, wherein seven variant homozygotes and 21 heterozygous mice departed phenotypically from 12 homozygous reference mice with a P value of 2.047 x 10-7 (Figure 2).  

 

The mutation corresponds to residue 859 in the mRNA sequence NM_001159774 (variant 1) within exon 9 of 22 total exons.

 

844 AAGAGCGAAGTGGACATCGTTGTTAGTGAAGAC

238 -K--S--E--V--D--I--V--V--S--E--D-

 

The mutated nucleotide is indicated in red.  The mutation results in an isoleucine to leucine substitution at position 243 (I243L) in both isoforms of the inhibitor of kappa-B kinase-β (IKK-β; alternatively, IKK-2) protein, and is strongly predicted by PolyPhen-2 to cause loss of function (score = 0.782).

Protein Prediction
Figure 3. Protein domain organization of IKK-2. IKK-2 has a kinase domain, C-terminal dimerization domain (SDD), a leucine zipper, a helix-loop-helix (HLH) domain, and a NEMO binding domain (NBD). The Baby mutation results in an isoleucine to leucine substitution at position 243 (I243L). The image is interactive; click the other mutations to view more information.

IKK-2 is a component of the IKK complex, which is necessary for NF-κB activation. The IKK complex is composed of two highly homologous catalytic subunits (IKK-1 (alternatively, IKK-α) and IKK-2), the regulatory subunit NEMO (or IKK-γ; see the record for panr2) that links the catalytic subunits to upstream activators and signaling complexes, and less well-characterized accessory proteins such as HSP90, Cdc37, and ELKS [for review see (1;2)]. 

 

Similar to IKK-1, IKK-2 has a kinase domain (amino acids 15-300), a C-terminal α-helical scaffold/dimerization domain (SDD; amino acids 408-664) that mediates homo- and heterodimerization of IKK-2, a leucine zipper (LZ; amino acids 458-479), a helix-loop-helix (HLH) region (amino acids 603-642), and a NEMO binding domain (NBD; amino acids 737-742) (Figure 3) (3;4). Unique to IKK-2 is a ubiquitin-like domain (ULD; amino acids 307-384), which is essential for the kinase activity of IKK-2 (5;6). Mutations within the ULD result in an inability of the IKK complex to activate NF-κB in response IL-1 and TNF (see the record for Panr1). Leu353 within the ULD is required for the dissociation of IKK-2 from the p65 NF-κB subunits after the phosphorylation and degradation of IκBα. Both the ULD and the SDD mediate the exact positioning of the IκBα substrate.

 

The Baby mutation results in an isoleucine to leucine substitution at position 243 (I243L) within the kinase domain in the IKK-2 protein.

 

Please see the record Impaired for more information about Ikbkb.

Putative Mechanism

The NF-κB signaling pathway functions in essentially all mammalian cell types and is activated in response to injury, infection, inflammation and other stressful conditions requiring rapid reprogramming of gene expression. NF-κB regulates both innate and adaptive immune responses, including those mediated by the toll-like receptors (TLRs), TNF receptors, the IL-1 receptor, and the B and T cell receptors (BCR and TCR, respectively). In the resting cell, NF-κB dimers are kept inactive in the cytoplasm through their association with IκB inhibitory molecules, including p105 and p100.  In response to stimulation, IκBs are phosphorylated by the IKK complex at conserved serine residues (2). This modification induces the K48-linked polyubiquitination of IκB molecules and subsequent recognition by the 26S proteasome as substrates for proteolysis.  Degradation of IκBs allows the NF-κB dimers to translocate into the nucleus, where they are able to activate the transcription of target genes, including various cytokines [for review see (7)].

 

Genetic studies have demonstrated that the IKK-2 and NEMO subunits of IKK are required for NF-κB activation by most stimuli (i.e., canonical stimulation) including inflammatory cytokines (IL-1 and TNFα), endotoxins (e.g., lipopolysaccharide), viral infection, exposure to double-strand RNA, and UV-irradiation (8). Although NEMO binds preferentially to IKK-2, it can interact with IKK-1 (9), providing some functional redundancy between the two kinases (10). In addition to activating the canonical NF-κB pathway, IKK-2 and NEMO are necessary to activate the tumor progression locus 2 (TPL2; see the record for Sluggish), a MAP3 kinase that activates the MEK/ERK pathway in response to TLR, TNF-α, and CD40 signaling (11). The IKK complex also plays an important role in the production of type I IFNs upstream of the IKK-related kinases IKK-i/ε and TANK-binding kinase 1 (TBK1; see the record for Pioneer), and downstream of the RNA helicase RIG-I, which detects RNA virus infection intracellularly (12).   

 

Mutations in IKBKB has been linked to immunodeficiency 15 (IMD15; OMIM: #615592) (13;14). IMD15 is characterized by early-onset bacterial, fungal, and viral infections as well as a failure to thrive. Patients with IMD15 exhibit hypo- or agammaglobulinemia with relatively normal numbers of B and T cells. Differentiation and activation of immune cells in patients with IMD15 are impaired (14).

 

Ikbkb-deficient (Ikbkb-/-) mice are embryonically lethal by embryonic day 13 (E13), mainly due to TNF-induced hepatocyte apoptosis (15;16). B-cell-specific knockouts of both IKK-2 and NEMO resulted in a lack of B cells in the spleen, suggesting that canonical NF-κB activation is required for the maintenance of mature B cells (17). IKK-2 function in follicular and marginal zone B cells is essential for B cell development (17). B cell specific deletion of Ikbkb resulted in reduced frequencies of peripheral B cells due to defects in cell survival (18). In addition, immune responses to LPS, anti-CD40, and anti-IgM were impaired compared to that in wild-type mice (18). Mice with T-cell-restricted NEMO ablation or with replacement of IKK-2 with a kinase-dead mutant prevented survival of peripheral T cells (19). In addition, IKK-2 in T cells is essential for the development of natural killer T (NKT) cells and CD4+/CD25+ regulatory T cells (20).

 

The Baby mice exhibited defects in T cell frequencies in the peripheral blood under normal conditions, indicating that IKK-2Baby lost some function in T cells. B cell development in the Baby mice appeared normal, indicating some residual IKK-2Baby function in B cells.

Primers PCR Primer
Baby(F):5'- TCAATCACAGGATGGTGTTCTG -3'
Baby(R):5'- ACTCCTGCTGAACTCAATGC -3'

Sequencing Primer
Baby_seq(F):5'- TCAAAAGTTATGCATGGGCCTG -3'
Baby_seq(R):5'- CTGCTGAACTCAATGCTTAGAGC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler