Phenotypic Mutation 'Big_mac' (pdf version)
AlleleBig_mac
Mutation Type missense
Chromosome18
Coordinate66,859,856 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Mc4r
Gene Name melanocortin 4 receptor
Synonym(s) Fatboy
Chromosomal Location 66,857,715-66,860,472 bp (-)
MGI Phenotype FUNCTION: This gene encodes a member of the melanocortin receptor family. Melanocortin receptors are transmembrane G-protein coupled receptors, which respond to small peptide hormones and exhibit diverse functions and tissue type localization. As part of the central nervous melanocortin system, the encoded protein is competitively bound by either melanocyte stimulating hormone or agouti-related protein to regulate energy homeostasis. Disruption of this gene promotes hyperphagia and obesity, and is associated with increased cholesterol levels and insulin resistance. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mutations in this gene result in hyperglycemia and weight gain. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_016977; MGI:99457

Mapped Yes 
Amino Acid Change Asparagine changed to Isoleucine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000054776]
SMART Domains Protein: ENSMUSP00000054776
Gene: ENSMUSG00000047259
AA Change: N62I

DomainStartEndE-ValueType
Pfam:7tm_4 51 228 8.1e-11 PFAM
Pfam:7TM_GPCR_Srsx 55 317 6e-12 PFAM
Pfam:7tm_1 61 302 2.7e-31 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000057942)
Meta Mutation Damage Score 0.526 question?
Is this an essential gene? Probably nonessential (E-score: 0.115) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - increased
Body Weight (Female) - increased
Body Weight (Male) - increased
Body Weight (Z-score) - increased
FACS NK cells - decreased
Motor: Rotarod Weight - increased
Motor: Rotarod Weight (Z-score) - increased
Candidate Explorer Status CE: excellent candidate; human score: 2; ML prob: 0.86
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(21) : Chemically induced (ENU)(10) Targeted(11)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Mc4r APN 18 66859158 missense probably benign 0.01
IGL01382:Mc4r APN 18 66859793 missense probably damaging 0.96
IGL01820:Mc4r APN 18 66859155 missense probably benign 0.00
IGL02749:Mc4r APN 18 66859662 missense probably damaging 1.00
IGL02812:Mc4r APN 18 66859247 missense probably damaging 1.00
IGL03403:Mc4r APN 18 66859526 missense possibly damaging 0.61
Big_boned UTSW 18 66859488 missense probably damaging 1.00
blubbery UTSW 18 66859182 missense probably damaging 1.00
Cetacean UTSW 18 66859180 nonsense probably null
chubby UTSW 18 66859847 missense probably damaging 1.00
halloween UTSW 18 66859821 missense probably damaging 1.00
southbeach UTSW 18 66859142 missense probably damaging 1.00
R1552:Mc4r UTSW 18 66859695 missense probably benign 0.00
R1623:Mc4r UTSW 18 66859997 missense probably benign 0.03
R1666:Mc4r UTSW 18 66859409 missense probably damaging 1.00
R1668:Mc4r UTSW 18 66859409 missense probably damaging 1.00
R1781:Mc4r UTSW 18 66859847 missense probably damaging 1.00
R1873:Mc4r UTSW 18 66859460 missense probably damaging 1.00
R2105:Mc4r UTSW 18 66859598 missense probably damaging 1.00
R2210:Mc4r UTSW 18 66859395 missense probably damaging 1.00
R3714:Mc4r UTSW 18 66859821 missense probably damaging 1.00
R3715:Mc4r UTSW 18 66859821 missense probably damaging 1.00
R4115:Mc4r UTSW 18 66859979 missense probably benign
R4322:Mc4r UTSW 18 66859050 missense probably benign 0.00
R4492:Mc4r UTSW 18 66859640 missense probably benign 0.00
R4806:Mc4r UTSW 18 66859488 missense probably damaging 1.00
R4877:Mc4r UTSW 18 66859338 missense probably benign 0.00
R6161:Mc4r UTSW 18 66859180 nonsense probably null
R6802:Mc4r UTSW 18 66859417 missense probably benign 0.21
R6807:Mc4r UTSW 18 66859856 missense probably damaging 1.00
R6929:Mc4r UTSW 18 66859182 missense probably damaging 1.00
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-05-25 7:25 AM by Diantha La Vine
Record Created 2019-04-01 9:33 PM by Bruce Beutler
Record Posted 2019-04-03
Phenotypic Description
Figure 1. Big_mac mice exhibited increased body weights. Scaled weight data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Big_mac phenotype was identified among G3 mice of the pedigree R6807, some of which showed increased body weights compared to wild-type littermates (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the increased body weights using an additive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 72 mutations (X-axis) identified in the G1 male of pedigree R6807. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 72 mutations. The increased body weight phenotype was linked to a mutation in Mc4r: an A to T transversion at base pair 66,859,856 (v38) on chromosome 18, or base pair 632 in the GenBank genomic region NC_000084 for the Mc4r gene. Linkage was found with an additive model of inheritance (P = 1.234 x 10-7), wherein two variant homozygotes and 18 heterozygous mice departed phenotypically from eight homozygous reference mice (Figure 2).

 

The mutation corresponds to residue 632 in the mRNA sequence NM_016977 within exon 1 of 1 total exons. 

 

616 ATAAGCCTGTTGGAGAACATTCTAGTGATCGTG

57  -I--S--L--L--E--N--I--L--V--I--V-

 

The mutated nucleotide is indicated in red. The mutation results in an asparagine to isoleucine substitution at position 62 (N62I) in the MC4R protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 1.000).

Protein Prediction
Figure 3. Domain structure and topography of mouse MC4R. The locations of the transmembrane (TM) domains are indicated. The Big_mac mutation causes an asparagine to isoleucine substitution at position 62 (N62I) of the MC4R protein. The image is interactive; click to view other MC4R mutations.
Figure 4. 3D model of Melanocortin-4 receptor. The locations of the Big_mac, Big_boned, Cetaceanchubby, halloween, and Southbeach mutations are indicated. UCSF Chimera model is based on PDB 2IQR. Click on the 3D structure to view it rotate.

MC4R belongs to the family of melanocortin receptors, which are seven transmembrane (TM) spanning G-protein coupled receptors (GPCRs) (Figure 3 & 4). MC4R activates the heterotrimeric G-protein Gs, which stimulates adenylyl cyclase production of cAMP from ATP (1). GPCRs have seven transmembrane helices connected by loops, and ligand binding occurs at extracellular loops facilitated by specific transmembrane helices. Based on a pure modeling approach modeled upon the crystal structure of bovine rhodopsin, another GPCR, residues in transmembrane domain (TM)3, TM4, TM5 and TM6 were predicted to flank the ligand binding site. Extracellular loops 2 and 3 also participate in docking of ligand (2). Interestingly, TM1 and TM7 were not predicted to contribute to ligand binding, although F284 was found at the edge of the ligand-binding pocket (2). The third intracellular loop of MC4R is predicted to form an α-helical segment, and play an important role in coupling the receptor to Gs.

 

The Big_mac mutation results in an asparagine to isoleucine substitution at position 62 (N62I); Asn62 is within the first transmembrane domain.

 

Please see the record for Southbeach for more information about Mc4r.

Putative Mechanism

A main mechanism of energy balance regulation involves the control of signaling by the central melanocortin receptors (MCRs) MC3R and MC4R within a defined hypothalamic neural network. Two sets of neurons in the arcuate nucleus (a region surrounding the third ventricle in the most ventral portion of the hypothalamus) act as sensors of whole-body energy status and initiate signals to maintain energy stores at a constant level. The Agrp/Npy neurons (producing Agrp and neuropeptide Y) are inhibited by the leptin peptide (see the record for Potbelly) by signaling through the leptin receptor (see the record for Business_class), while Pomc/Cart neurons (producing Pomc; its proteolytic products and cocaine- and amphetamine-regulated transcript) are stimulated by leptin (3-5). Both Agrp/Npy and Pomc/Cart neurons synapse onto MC4R-expressing neurons (3;6). Thus, when leptin levels are low, Agrp/Npy neurons are activated and Pomc/Cart neurons are inhibited, producing Agrp but not Pomc, and resulting in inhibition of MC4R and increased food intake.

 

In humans, mutations in MC4R are associated with obesity (OMIM #601665). Human patients with MC4R mutations exhibit increased body mass index, increased appetite, increased height, increased lean mass, increased bone mineral density and hyperinsulinemia (7). With the exception of increased bone mineral density, these phenotypes are recapitulated in Mc4r null mice (8).

 

The obesity phenotype observed in the Big_mac mice mirrored that of other ENU-induced mutations attributed to Mc4r, including Southbeach and Fatboy (MGI:2671841) (9). The localization, expression, and function of the MC4RBig_mac protein have not been determined; however, the obesity phenotype of the Big_mac mice indicates that the mutation results in loss of MC4R function.

Primers PCR Primer
Big_mac(F):5'- TGTTCACGGTGAAGCTCTGG -3'
Big_mac(R):5'- TCAGTTCAAGGAGGACTCAAATC -3'

Sequencing Primer
Big_mac_seq(F):5'- TGAAGCTCTGGGCATCCGTATC -3'
Big_mac_seq(R):5'- GAGGACTCAAATCCAGCTGCTG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsZhao Zhang and Bruce Beutler