Phenotypic Mutation 'spartacus' (pdf version)
Allelespartacus
Mutation Type missense
Chromosome19
Coordinate5,760,826 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Scyl1
Gene Name SCY1-like 1 (S. cerevisiae)
Synonym(s) 2810011O19Rik, mfd, mdf, Ntkl, p105
Chromosomal Location 5,758,427-5,771,401 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional regulator belonging to the SCY1-like family of kinase-like proteins. The protein has a divergent N-terminal kinase domain that is thought to be catalytically inactive, and can bind specific DNA sequences through its C-terminal domain. It activates transcription of the telomerase reverse transcriptase and DNA polymerase beta genes. The protein has been localized to the nucleus, and also to the cytoplasm and centrosomes during mitosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation or a knock-out allele develop a motoneuron disease characterized by gait ataxia, reduced grip strength, tremors, progressive hindlimb paralysis, muscular atrophy, and motoneuron degeneration. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_023912, NM_001361921, NM_001361922; MGI:1931787

Mapped Yes 
Amino Acid Change Valine changed to Phenylalanine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000025890] [ENSMUSP00000080214]
SMART Domains Protein: ENSMUSP00000025890
Gene: ENSMUSG00000024941
AA Change: V488F

DomainStartEndE-ValueType
low complexity region 18 28 N/A INTRINSIC
Pfam:Pkinase_Tyr 30 254 3.3e-11 PFAM
Pfam:Pkinase 31 252 2e-14 PFAM
SCOP:d1gw5a_ 350 536 1e-18 SMART
low complexity region 556 577 N/A INTRINSIC
low complexity region 608 620 N/A INTRINSIC
coiled coil region 759 795 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
(Using ENSMUST00000025890)
Meta Mutation Damage Score 0.288 question?
Is this an essential gene? Probably essential (E-score: 0.940) question?
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological
Body Weight (BP Female) - decreased
Body Weight (BP Male) - decreased
Body Weight (BP) - decreased
Body Weight (BP, z-score) - decreased
Body Weight (DSS Female) - decreased
Body Weight (DSS Male) - decreased
Body Weight (DSS) - decreased
Body Weight (DSS, z-score) - decreased
FACS B1b cells - decreased
Motor: Rotarod Weight - decreased
Motor: Rotarod Weight (Z-score) - decreased
Candidate Explorer Status CE: excellent candidate; human score: -0.5; ML prob: 0.702
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(7) : Gene trapped(2) Spontaneous(1) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02437:Scyl1 APN 19 5766196 missense probably damaging 1.00
IGL02488:Scyl1 APN 19 5770313 nonsense probably null
IGL02816:Scyl1 APN 19 5770382 missense probably damaging 0.99
R1957:Scyl1 UTSW 19 5760104 missense probably benign 0.00
R2267:Scyl1 UTSW 19 5761721 missense possibly damaging 0.78
R4598:Scyl1 UTSW 19 5770453 missense probably damaging 1.00
R5034:Scyl1 UTSW 19 5759994 missense probably benign 0.01
R5203:Scyl1 UTSW 19 5771367 start gained probably benign
R6159:Scyl1 UTSW 19 5764757 missense probably benign 0.03
R6194:Scyl1 UTSW 19 5770306 missense possibly damaging 0.96
R6360:Scyl1 UTSW 19 5760571 missense probably damaging 1.00
R6625:Scyl1 UTSW 19 5760826 missense probably damaging 1.00
R7214:Scyl1 UTSW 19 5760029 missense probably benign
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-05-16 1:00 PM by Anne Murray
Record Created 2019-02-23 3:59 AM by Bruce Beutler
Record Posted 2019-05-16
Phenotypic Description

Figure 1. Spartacus mice exhibited reduced body weights compared to wild-type littermates. Scaled weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Spartacus mice exhibited reduced time on a rotarod during a rotarod performance test. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Spartacus mice exhibited ataxia.

The spartacus phenotype was identified among G3 mice of the pedigree R6625, some of which showed reduced body weights (Figure 1) as well as reduced time on a rotarod during a rotarod performance test (i.e., impaired coordination/motor capabilities) (Figure 2) compared to wild-type littermates. Some mice also showed ataxia (Figure 3).

Nature of Mutation

Figure 4. Linkage mapping of the reduced body weight phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 34 mutations (X-axis) identified in the G1 male of pedigree R6625. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 34 mutations. Both of the above anomalies were linked to mutations in three genes on chromosome 19: Scyl1, Ppp1r32, and Olfr1441. The mutation in Scyl1 was presumed causative as mutations in Scy1l are known to cause phenotypes similar to those observed in the spartacus mice (see MGI). The Scyl1 mutation is a G to T transversion at base pair 5,760,826  (v38) on chromosome 19, or base pair 10,589 in the GenBank genomic region NC_000085. The strongest association was found with a recessive model of inheritance to the body weight phenotype, wherein two variant homozygotes departed phenotypically from 26 homozygous reference mice and 41 heterozygous mice with a P value of 4.888 x 10-11 (Figure 4).   

 

The mutation corresponds to residue 1,551 in the mRNA sequence NM_023912 within exon 10 of 17 total exons.

 

1536 TCCCGGGTTGCGGGTGTCCTGGGCTTTGCTGCC

483  -S--R--V--A--G--V--L--G--F--A--A-

 

The mutated nucleotide is indicated in red. The mutation results in a valine to phenylalanine substitution at position 488 (V488F) in the SCYL1 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.999).

Protein Prediction
Figure 5. Domain organization of SCYL1. The spartacus mutation  results in a valine to phenylalanine substitution at position 488.

Scyl1 encodes Scy1-like 1 (SCYL1; alternatively, NTKL [N-terminal kinase-like] and p105), a member of the Scy1-like family of catalytically inactive protein kinases. SCYL1 has an N-terminal kinase-like domain. SCYL1 does not contain a kinase subdomain 1 (1;2). SCYL1 has three HEAT repeats and a coiled-coil. The HEAT repeats mediate SCYL1 oligomerization. SCYL1 has a C-terminal RKLD sequence that is similar to coatomer (COPI)-binding motifs in transmembrane ER proteins. The RKLD sequence mediates interactions with the appendage domain of the coatomer subunit γ-2 (alternatively, COPG2 or γ2-COP) (3).

 

SCYL1 undergoes alternative splicing to generate two variants that encode proteins of 791 (variant 1) and 707 (variant 2) amino acids (2). Variant 1 lacks half of exon 14, while variant 2 lacks most of exon 14, all of exon 15, and half of exon 16.

 

The spartacus mutation results in a valine to phenylalanine substitution at position 488 (V488F); Val488 is within an undefined region between the second and third HEAT repeats.

Expression/Localization

SCYL1 is ubiquitously expressed (1;2). SCYL1 is cytoplasmic and is localized at the interface between the Golgi apparatus and the membrane trafficking machinery mediated by coatomer (COPI)-coated vesicles (4).

Background
Figure 6. COPI vesicle formation. Newly synthesized proteins enter the ER and move on to the Golgi, where they are modified prior to being distributed through the secretory pathway to their final location. These newly synthesized proteins are folded into their proper conformation with the aid of ER-resident proteins known as chaperones. As chaperones often leave the ER and enter the Golgi along with their substrates, the retrieval of chaperones back to the ER is dependent upon the recognition of C-terminal KDEL-like motifs by KDEL receptors, and subsequent transportation in COPI vesicles. During COPI vesicle formation, coat proteins are recruited from the cytosol to the Golgi membrane as ARF1-GDP binds with p23. GBF1 activates ARF1 by promoting nucleotide exchange. ARF1-GTP then dissociates from p23 and stablizes on the membrane. ARF1-GTP then associates with p23/p24 heterooligomers, recruiting the coatomer from the cytosol to the Golgi membrane. SCYL1 interacts with components of COPI coats (b-COP and γ-COP) to regulate COPI-mediated retrograde protein trafficking at the interface between the Golgi apparatus and the ER. SCYL1 also interacts with class II ARFs to link the class II ARFs to γ2-bearing COPI subcomplexes. Coatomer and ARFGAP1 act as coat proteins and drive the budding and fission stages of vesicle formation. ARFGAP also drives inactivation of ARF1 by the hydrolysis of GTP to GDP, causing the vesicles to become uncoated at their target. The fission stage requires the catalyzation of PC to PA by PLD2. BARS and PA can then associate, promoting fission of the vesicle. Ligand-bound KDELR1 is able to associate with ARFGAP1.

The COPI complex has seven core subunits: α-COP, β’-COP, ε-COP, β-COP, δ-COP, γ-COP, and ζ-COP  (5-8). The COPI complex, along with other vesicle machinery (e.g., clathrin and COPII), promotes selection of cargo for vesicle trafficking as well as vesicle formation. The COPI complex is required for sorting of lipids and proteins within the Golgi cisternae and between the ER and Golgi (9;10). The COPI complex also functions in maintaining ER- and Golgi-resident chaperones in their respective compartments, endosomal transport and function, regulating lipid droplet homeostasis, mRNA transport, and the breakdown of the nuclear envelope [reviewed in (11)]. The COPI complex prevents the cell-surface expression of unassembled, dysfunctional proteins. The COPI complex recognizes cargo based on the presence of sorting signals within the cytoplasmic domains of the proteins (e.g., di-lysine KKxx and KxKxx motifs; arginine-based ER retrieval signals [ɸRxR; in which ɸ represents any hydrophobic amino acid]). The outer-coat COPI subunits α and β’ interact with dilysine K(X)KXX cargo motifs, and the adaptor subunit γ interacts with p23 transmembrane peptides (12-15). COPI-coated vesicles also promote the transport of K/HDEL cargoes associated with specific receptors (16); transport of HDEL-associated cargoes is dependent on δ-COP (17).

 

During formation of the COPI-coated vesicle, the cytoplasmic coatomer is recruited to membrane by the GTPase Arf1, which also regulate recruitment of COPI and clathrin-adaptor proteins. The F-subcomplex interacts with Arf1, subsequently recruiting the COPI complex to Golgi membranes. In the absence of cargo, inactive GDP-bound Arf1, the F-subcomplex (closed conformation), and the B-subcomplex are located in the cytoplasm. Upon cargo recognition, the B-subcomplex is recruited. Arf1 activation, via GDP-GTP exchange, promotes recruitment of the F-subcomplex via the γ-COP and β-COP subunits. Upon recruitment, the F-subcomplex transitions to an open conformation via an unknown mechanism.

SCYL1 is putatively involved in intracellular transport processes.

 

SCYL1 interacts with components of COPI coats (e.g., b-COP and γ-COP) to regulate COPI-mediated retrograde protein trafficking at the interface between the Golgi apparatus and the ER (3;4). RNAi-mediated SCYL1 knockdown resulted in aberrant COPI-mediated retrograde traffic of the KDEL receptor to the ER; anterograde trafficking was not affected (4). SCYL1 also interacts with class II ARFs (e.g., ARF4) to link the class II ARFs to γ2-bearing COPI subcomplexes (3).

 

SCYL1 is also a cytoplasmic component of the mammalian nuclear tRNA export machinery (18). SCYL1 binds tRNA and associates with the cytoplasmic side of the nuclear pore complex component Nup98 (18). SCYL1 also interacts with components of the nuclear tRNA export machinery (i.e., Xpo-t, Xpo-5, and Ran) (18). SCYL1 also putatively unloads the aminoacyl-tRNAs from the nuclear tRNA export receptor at the cytoplasmic side of the nuclear pore complex and channels them to the eukaryotic elongation factor eEF-1A for use in protein synthesis (18).

 

Mutations in SCYL1 are linked to cases of autosomal recessive spinocerebellar ataxia-21 (OMIM: #616719) (19;20). Patients with autosomal recessive spinocerebellar ataxia-21 show early childhood-onset of cerebellar ataxia associated with cerebellar atrophy. Patients also have recurrent liver failure episodes in the first decade of life, leading to chronic liver fibrosis and later-onset peripheral neuropathy. Some patients also show mild learning disabilities. Mutations in SCYL1 can cause recurrent early-onset low γ-glutamyl-transferase cholestasis, acute liver failure, and neurodegeneration (i.e., CALFAN syndrome) (21;22).

Putative Mechanism

Scyl1-deficient (Scyl1-/-) mice showed early-onset progressive motor neuron disease with growth retardation/reduced body weights, abnormal gait (waddling), muscle wasting, reduced grip strength, and paralysis of the hind paws (23;24). Muscles from the Scyl1-/- mice showed neurogenic atrophy, fiber type switching, and disuse atrophy (23). Scyl1-/- peripheral nerves showed axonal degeneration and segmental demyelination (23). Scyl1-/- mice showed a reduction in spinal ventral horn motor neuron numbers and evidence of inflammation (23). Homozygous Scyl1 mutant mice (the ‘muscle deficient’ [mdf] model) showed reduced body sizes and fertility, progressive neuromuscular atrophy, progressive reduction of forelimb grip strength, hindlimb paralysis, gait ataxia, abnormal hindlimb posture, and tremors (25-27). The mice also showed cerebellar atrophy, Purkinje cell loss, and optic nerve atrophy (27).

 

The phenotypes observed in the spartacus mice indicates loss of SCYL1-associated function.

Primers PCR Primer
spartacus(F):5'- TTAAAGGCCTGTGGAGTAGC -3'
spartacus(R):5'- TTTTAGACCTTGGTTGGCCC -3'

Sequencing Primer
spartacus_seq(F):5'- CAGCACTTCCAGGGTGTG -3'
spartacus_seq(R):5'- CCTGCCCTGGGAAGTGGAAAG -3'
References
  25. Womack, J. E., MacPike, A., and Meier, H. (1980) Muscle Deficient, a New Mutation in the Mouse. J Hered. 71, 68.
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsNanda Regmi, Zhao Zhang, Lauren Prince, Jamie Russell, and Bruce Beutler