The heights phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4824, some of which showed increased frequencies of T cells (Figure 1) and CD4+ T cells (Figure 2) in the peripheral blood.

Whole exome HiSeq sequencing of the G1 grandsire identified 108 mutations. The B1 cell phenotype was linked by continuous variable mapping to mutations in two genes on chromosome 16: Cebpd and Klhl6. The mutation in Klhl6 was presumed causative as the immune phenotypes observed in heights mice mimics that of other Klhl6 mutant alleles. The Klhl6 mutation is a G to A transition at base pair 19,957,028 (v38) on chromosome 16, or base pair 26,082 in the GenBank genomic region NC_000082 encoding Klhl6. The strongest association was found with a recessive model of inheritance to the CD4+ T cell phenotype, wherein two variant homozygotes mice departed phenotypically from six homozygous reference mice and 10 heterozygous with a P value of 6.508 x 10^-5 (Figure 3).  

The mutation corresponds to residue 885 in the mRNA sequence NM_183390 within exon 3 of 7 total exons.

869 GCAGACCCTCTTATTAGACAGTGCCCTGAAGTC

The mutated nucleotide is indicated in red. The mutation results in an arginine to histidine substitution at position 260 (R260H) in the KLHL6 protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.978).

KLHL6 is a member of the Kelch-like family (see the record for teeny for information about KBTBD2, another Kelch-like family member). Similar to other Kelch-like family members, KLHL6 has a Bric-a-brac, Tramtrack, Broad-complex (BTB) domain at the N-terminus, a BACK domain, and a kelch repeat region at the C-terminus (KLHL6 has five or six kelch repeats) (Figure 4) (1). BTB domains facilitate protein-protein interactions, the BACK domain has no known function, and Kelch domains form a tertiary structure of β-propellers that have a role in extracellular functions, morphology, and binding to other proteins.

The heights mutation results in an arginine to histidine substitution at position 260 (R260H); amino acid 260 is within the BACK domain.

KLHL6 has putative functions in B cell receptor-associated signal transduction and germinal center responses (2). Loss of KLHL6 expression results in impaired transitional B cell survival and differentiation (3). Klhl6-deficient (Klhl6^-/-) mice exhibited impaired B cell development past the immature stage, reduced numbers of B220+ and CD3- B cells in the spleen and peripheral blood, reduced numbers of follicular B cells in the lymph nodes, reduced spleen weight, spleen hypoplasia, impaired germinal center formation, and impaired memory IgG responses (2). Mice homozygous for an ENU-induced Klhl6 mutation (W267*) exhibited increased numbers of immature B cells, but reduced numbers of mature B cells (MGI).

Putative functions for KLHL6 in T cells has not been described. The role of KLHL6 in B cells is unknown, but it may contribute to cell proliferation and cell survival through interactions with proteins (e.g., HBXIP and Cul3) (3). The phenotype observed in the heights mice indicate loss of KLHL6-associated function in T cells.

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 415 nucleotides is amplified (chromosome 16, - strand):

1   ttggacagtt taaagatgca agtccaaagt tacatcattc aaaactttgt tcagattctg
61  aattccgagg agttccttga acttcctgtg gacactttgt accacatctt gaggagtgac
121 gacctgtgtg tgactgaaga ggctcaggtg tttgagactg tgatgagctg ggtccggcac
181 aaacaatcag aacgactctg cctgctccct tgtgtcctcg agaatgtgcg tttaccactt
241 ctggatccgt ggtacttcgt ggagatggtt gaagcagacc ctcttattag acagtgccct
301 gaagtcttcc cgctgcttca ggaagccagg atgtaccacc tttctggcaa tgaggtgagt
361 tggacttgag aggtatttca ttttgttggg aatgtaaggc attatccagg gactc

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.