Phenotypic Mutation 'Guardate' (pdf version)
AlleleGuardate
Mutation Type missense
Chromosome19
Coordinate25,149,831 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Dock8
Gene Name dedicator of cytokinesis 8
Synonym(s) A130095G14Rik, 5830472H07Rik, 1200017A24Rik
Chromosomal Location 24,999,529-25,202,432 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_028785; MGI:1921396

Mapped Yes 
Amino Acid Change Tyrosine changed to Histidine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000025831]
PDB Structure
Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: Y1058H

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Predicted Effect probably benign

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
(Using ENSMUST00000025831)
Meta Mutation Damage Score 0.366 question?
Is this an essential gene? Probably nonessential (E-score: 0.095) question?
Phenotypic Category
Phenotypequestion? Literature verified References
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
Candidate Explorer Status CE: excellent candidate; human score: 0.5; ML prob: 0.546
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(17) : Chemically induced (ENU)(5) Endonuclease-mediated(2) Gene trapped(4) Spontaneous(2) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25127711 critical splice donor site probably benign
primurus APN 19 25183609 missense probably damaging 1.00
IGL00737:Dock8 APN 19 25182976 missense probably benign 0.00
IGL00755:Dock8 APN 19 25051509 missense probably benign 0.09
IGL00822:Dock8 APN 19 25188409 nonsense probably null
IGL00838:Dock8 APN 19 25175459 nonsense probably null
IGL01419:Dock8 APN 19 25119452 missense probably benign 0.08
IGL01456:Dock8 APN 19 25119499 missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25169441 missense probably damaging 0.99
IGL01602:Dock8 APN 19 25089888 splice site probably benign
IGL01605:Dock8 APN 19 25089888 splice site probably benign
IGL01753:Dock8 APN 19 25061292 splice site probably benign
IGL01843:Dock8 APN 19 25089928 missense probably benign 0.02
IGL02032:Dock8 APN 19 25130405 missense probably damaging 0.99
IGL02073:Dock8 APN 19 25200986 critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25078205 critical splice donor site probably null
IGL02402:Dock8 APN 19 25078145 missense probably benign 0.25
IGL02529:Dock8 APN 19 25100926 nonsense probably null
IGL02728:Dock8 APN 19 25132220 missense probably benign
IGL02739:Dock8 APN 19 25188488 missense probably damaging 1.00
IGL03037:Dock8 APN 19 25086181 missense probably benign 0.02
IGL03104:Dock8 APN 19 25201020 nonsense probably null
IGL03137:Dock8 APN 19 25155948 missense probably benign 0.19
IGL03365:Dock8 APN 19 25099684 missense possibly damaging 0.70
Defenseless UTSW 19 25051563 missense probably benign 0.00
Pap UTSW 19 25122441 missense probably benign 0.31
snowdrop UTSW 19 25184941 critical splice donor site probably null
warts_and_all UTSW 19 25169501 critical splice donor site probably null
R0021:Dock8 UTSW 19 25163047 missense probably benign 0.01
R0147:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0148:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0294:Dock8 UTSW 19 25188350 missense probably damaging 1.00
R0537:Dock8 UTSW 19 25171577 missense probably benign 0.08
R0630:Dock8 UTSW 19 25061160 missense probably benign 0.10
R1163:Dock8 UTSW 19 25051503 missense probably benign
R1164:Dock8 UTSW 19 25090027 missense probably benign 0.44
R1471:Dock8 UTSW 19 25201036 missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25051563 missense probably benign 0.00
R1803:Dock8 UTSW 19 25132235 missense probably benign 0.00
R1822:Dock8 UTSW 19 25161058 missense probably benign 0.31
R1852:Dock8 UTSW 19 25127128 missense probably benign 0.45
R1916:Dock8 UTSW 19 25061157 missense probably benign 0.02
R1984:Dock8 UTSW 19 25121181 missense probably null 0.95
R2311:Dock8 UTSW 19 25183004 missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25200393 missense probably damaging 0.99
R2483:Dock8 UTSW 19 25079877 missense probably benign
R3116:Dock8 UTSW 19 25188494 missense probably benign 0.00
R3157:Dock8 UTSW 19 25149831 missense probably benign
R3623:Dock8 UTSW 19 25079877 missense probably benign
R3624:Dock8 UTSW 19 25079877 missense probably benign
R3800:Dock8 UTSW 19 25164352 missense probably benign 0.08
R3844:Dock8 UTSW 19 25065430 nonsense probably null
R3895:Dock8 UTSW 19 25051501 missense probably benign 0.31
R3901:Dock8 UTSW 19 25100905 missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25184941 critical splice donor site probably null
R4428:Dock8 UTSW 19 25200499 missense probably damaging 0.98
R4428:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4429:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4431:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4545:Dock8 UTSW 19 25188358 missense probably damaging 1.00
R4839:Dock8 UTSW 19 25169494 missense probably benign 0.00
R4897:Dock8 UTSW 19 25181637 missense probably benign 0.00
R4939:Dock8 UTSW 19 25122400 missense probably damaging 1.00
R4995:Dock8 UTSW 19 25158383 missense probably benign 0.02
R5035:Dock8 UTSW 19 25086207 missense probably damaging 0.99
R5294:Dock8 UTSW 19 25061153 missense probably benign 0.01
R5324:Dock8 UTSW 19 25163094 missense probably benign 0.17
R5478:Dock8 UTSW 19 25079822 missense probably benign
R5704:Dock8 UTSW 19 25174222 missense probably damaging 1.00
R5724:Dock8 UTSW 19 25122421 missense probably damaging 1.00
R5745:Dock8 UTSW 19 25130397 missense probably benign 0.02
R5864:Dock8 UTSW 19 25061220 missense probably damaging 0.99
R5870:Dock8 UTSW 19 25132126 missense probably benign
R5893:Dock8 UTSW 19 25122447 missense probably damaging 1.00
R5954:Dock8 UTSW 19 25171619 missense probably damaging 1.00
R6087:Dock8 UTSW 19 25161074 missense probably benign 0.00
R6223:Dock8 UTSW 19 25161052 missense probably benign 0.00
R6391:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25127484 missense probably damaging 0.99
R6786:Dock8 UTSW 19 25183022 missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25122441 missense probably benign 0.31
R6818:Dock8 UTSW 19 25169501 critical splice donor site probably null
R6885:Dock8 UTSW 19 25147378 missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25188382 missense probably damaging 1.00
R6923:Dock8 UTSW 19 25095606 missense probably benign
R7001:Dock8 UTSW 19 25099677 missense probably benign
R7141:Dock8 UTSW 19 25181620 missense probably null 0.75
R7203:Dock8 UTSW 19 25181563 missense probably damaging 1.00
R7257:Dock8 UTSW 19 25127085 missense probably benign 0.08
R7296:Dock8 UTSW 19 25184881 missense probably benign 0.00
X0027:Dock8 UTSW 19 25161129 missense probably benign
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:31 PM by Diantha La Vine
Record Created 2019-01-22 11:02 AM by Bruce Beutler
Record Posted 2019-02-01
Phenotypic Description

Figure 1. Guardate mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The Guardate phenotype was identified among G3 mice of the pedigree R3157, some of which showed diminished T-dependent antibody response to ovalbumin administered with aluminum hydroxide (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced T-dependent IgG responses to ovalbumin administered with aluminum hydroxide using a dominant model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 49 mutations (X-axis) identified in the G1 male of pedigree R3157. Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 49 mutations. The diminished T-dependent antibody response phenotype was linked by continuous variable mapping to a mutation in Dock8: a T to C transition at base pair 25,149,831 (v38) on chromosome 19, or base pair 150,321 in the GenBank genomic region NC_000085 encoding the Dock8 gene. Linkage was found with a dominant model of inheritance, wherein eight variant homozygotes and 26 heterozygous mice departed phenotypically from 18 homozygous reference mice with a P value of 0.000640 (Figure 2).

 

The mutation corresponds to residue 3,294 in the mRNA sequence NM_028785 within exon 26 of 48 total exons.

 

3279 CTTGCCTTCTTCCTGTATGACCTCCTGTCAATC
1053 -L--A--F--F--L--Y--D--L--L--S--I-

 

The mutated nucleotide is indicated in red. The mutation results in a tyrosine to histidine substitution at position 1,058 (Y1058H) in the DOCK8 protein, and is strongly predicted by Polyphen-2 to be benign (score = 0.000).

Protein Prediction

Figure 3. Domain structure of DOCK8, a member of the DOCKC subfamily. The DHR-1 domain shares a weak homology to the C2 domain. The large DHR-2 domain interacts with the nucleotide-free form of Rac and/or Cdc42. The Guardate mutation results in a tyrosine to histidine substitution at position 1,058 (Y1058H). This image is interactive. Other mutations found in DOCK8 are noted in red. Click on each mutation for more specific information.

DOCK8 belongs to the DOCK180 superfamily of guanine nucleotide exchange factors (GEFs) that have been shown to activate members of the Rho family of small GTPases (1-4). The DOCK C subfamily (which includes DOCK8 and DOCK7; see the record for moonlight) has dual specificity for Rac and Cdc42 (1;3;5;6).  Two domains are shared amongst all DOCK proteins, the catalytic DHR-2 (DOCK homology region 2) or CZH-2 (CDM-zizimin homology 2) domain and the DHR-1 or CZH-1 domain (Figure 3).  The DHR-1 domain is located N-terminal to the DHR-2 domain (2;4).

 

The Guardate mutation results in a tyrosine to histidine substitution at position 1,058 (Y1058H). Thr44 is within an undefined region between the DHR-1 and DHR-2 domains.

 

Please see the record for captain morgan for more information on Dock8.

Putative Mechanism

The Rho GTPases are known regulators of the actin cytoskeleton and affect multiple cellular activities including cell morphology, polarity, migration, proliferation and apoptosis, phagocytosis, cytokinesis, adhesion, vesicular transport, transcription and neurite extension and retraction. Like DOCK2, DOCK8 is likely to regulate the activity of GTPases and thus be involved in cytoskeletal changes associated with various cellular processes. DOCK8 is proposed to serve as an effector downstream of CD19 and PI3K to promote G protein signaling events critical for integrin polarization at the synapse and for the survival of marginal zone B cells and germinal center (GC) B cells. 

 

During a T cell-dependent humoral immune response, CD4+ T helper cell subsets including TFH, Th1 and Th2 cells migrate to the T cell/B cell borders in SLO, and interact with cognate antigen-specific B cells through the pairing of T cell and B cell surface ligands and receptors such as CD40 with its ligand (see the record for walla).  This interaction results in the secretion by T helper cells of certain cytokines known to promote B cell survival, proliferation, and antibody production (7;8).

 

In humans, DOCK8 deficiency results in an autosomal recessive form of hyper-IgE recurrent infection syndrome (HIES; OMIM #243700) (9;10).  Autosomal dominant HIES is characterized by recurrent Staphylococcus aureus skin abscesses, increased serum IgE, and abnormalities of the connective tissue, skeleton, and dentition (11).  The autosomal recessive form shares hyper-IgE, eosinophilia, and recurrent Staphylococcal infections, but is distinguished from autosomal dominant HIES by the lack of connective tissue and skeletal involvement (12). Patients with DOCK8 deficiency are unusually susceptible to viral infections and virally-caused cancers.  Reduced numbers of T, B, and NK cells have been reported along with a selective defect in CD8+ T cell activation (9).  However, another study suggests most patients have normal numbers of B and NK cells, a greater decrease in the CD4+ T cell population than the CD8+ T cell population, and a more comprehensive T cell activation defect involving both T cell subsets (10).  Both autosomal dominant and autosomal recessive HIES are linked to a lack of Th17 cell function including the failure to produce the interleukin 17 (IL-17) cytokine (12).  Th17 are a subset of CD4+ T helper cells that play an important role in the development of autoimmune diseases like rheumatoid arthritis, as well as being critical in the clearance of fungal and extracellular bacterial infections (13).    

 

The relatively normal initiation of antibody production by mice with Dock8 mutations suggests that the extrafollicular B cell clonal expansion, plasma cell formation and immunoglobulin class switching, which depends on interactions with T helper cells, is intact.  However, subsequent antibody responses and affinity maturation occurring in the GCs is significantly impaired. The humoral deficits are due to a defect in GC B cell survival and selection during the affinity maturation phase of GC responses (14).

 

The phenotype of the Guardate mice indicates loss of DOCK8-associated function.

Primers PCR Primer
Guardate(F):5'- TGCATGTACAGAACAAGACCG -3'
Guardate(R):5'- ATCCAGGGTAGCCAAAGGAC -3'

Sequencing Primer
Guardate_seq(F):5'- CATGTACAGAACAAGACCGATGGG -3'
Guardate_seq(R):5'- CGCACACTCTACAGATGGTG -3'
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 411 nucleotides is amplified (chromosome 19, + strand):


1   tgcatgtaca gaacaagacc gatggggaaa aaaaaataca tctagaatta aacttcaccc
61  agaaggatgg tgggccaatg taatagtctc ttcctctccc agtgtagttc cagtccaggg
121 ctaaacagta tggtgtgtgc ctctgctgct cttacaggaa agcgagcagg cagaaaagat
181 caacatcagc cttgccttct tcctgtatga cctcctgtca atcatggaca gaggcttcgt
241 gttcaacctc atcaagcatt actgcagcca ggtgagcgcc ccggagctgc ggctcagccc
301 cttcccaccc actgcttatg tgacagagta ttgccctctt cagtgtgacc ccccacacat
361 cttggacttt caccatctgt agagtgtgcg ggtcctttgg ctaccctgga t


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Jin Huk Choi, and Bruce Beutler