The Guardate phenotype was identified among G3 mice of the pedigree R3157, some of which showed diminished T-dependent antibody response to ovalbumin administered with aluminum hydroxide (Figure 1).

Whole exome HiSeq sequencing of the G1 grandsire identified 49 mutations. The diminished T-dependent antibody response phenotype was linked by continuous variable mapping to a mutation in Dock8: a T to C transition at base pair 25,149,831 (v38) on chromosome 19, or base pair 150,321 in the GenBank genomic region NC_000085 encoding the Dock8 gene. Linkage was found with a dominant model of inheritance, wherein eight variant homozygotes and 26 heterozygous mice departed phenotypically from 18 homozygous reference mice with a P value of 0.000640 (Figure 2).

The mutation corresponds to residue 3,294 in the mRNA sequence NM_028785 within exon 26 of 48 total exons.

3279 CTTGCCTTCTTCCTGTATGACCTCCTGTCAATC

1053 -L--A--F--F--L--Y--D--L--L--S--I-

The mutated nucleotide is indicated in red. The mutation results in a tyrosine to histidine substitution at position 1,058 (Y1058H) in the DOCK8 protein, and is strongly predicted by Polyphen-2 to be benign (score = 0.000).

DOCK8 belongs to the DOCK180 superfamily of guanine nucleotide exchange factors (GEFs) that have been shown to activate members of the Rho family of small GTPases (1-4). The DOCK C subfamily (which includes DOCK8 and DOCK7; see the record for moonlight) has dual specificity for Rac and Cdc42 (1;3;5;6).  Two domains are shared amongst all DOCK proteins, the catalytic DHR-2 (DOCK homology region 2) or CZH-2 (CDM-zizimin homology 2) domain and the DHR-1 or CZH-1 domain (Figure 3).  The DHR-1 domain is located N-terminal to the DHR-2 domain (2;4).

The Guardate mutation results in a tyrosine to histidine substitution at position 1,058 (Y1058H). Thr44 is within an undefined region between the DHR-1 and DHR-2 domains.

Please see the record for captain morgan for more information on Dock8.

The Rho GTPases are known regulators of the actin cytoskeleton and affect multiple cellular activities including cell morphology, polarity, migration, proliferation and apoptosis, phagocytosis, cytokinesis, adhesion, vesicular transport, transcription and neurite extension and retraction. Like DOCK2, DOCK8 is likely to regulate the activity of GTPases and thus be involved in cytoskeletal changes associated with various cellular processes. DOCK8 is proposed to serve as an effector downstream of CD19 and PI3K to promote G protein signaling events critical for integrin polarization at the synapse and for the survival of marginal zone B cells and germinal center (GC) B cells. 

During a T cell-dependent humoral immune response, CD4⁺ T helper cell subsets including T_FH, Th1 and Th2 cells migrate to the T cell/B cell borders in SLO, and interact with cognate antigen-specific B cells through the pairing of T cell and B cell surface ligands and receptors such as CD40 with its ligand (see the record for walla).  This interaction results in the secretion by T helper cells of certain cytokines known to promote B cell survival, proliferation, and antibody production (7;8).

In humans, DOCK8 deficiency results in an autosomal recessive form of hyper-IgE recurrent infection syndrome (HIES; OMIM #243700) (9;10).  Autosomal dominant HIES is characterized by recurrent Staphylococcus aureus skin abscesses, increased serum IgE, and abnormalities of the connective tissue, skeleton, and dentition (11).  The autosomal recessive form shares hyper-IgE, eosinophilia, and recurrent Staphylococcal infections, but is distinguished from autosomal dominant HIES by the lack of connective tissue and skeletal involvement (12). Patients with DOCK8 deficiency are unusually susceptible to viral infections and virally-caused cancers.  Reduced numbers of T, B, and NK cells have been reported along with a selective defect in CD8⁺ T cell activation (9).  However, another study suggests most patients have normal numbers of B and NK cells, a greater decrease in the CD4⁺ T cell population than the CD8⁺ T cell population, and a more comprehensive T cell activation defect involving both T cell subsets (10).  Both autosomal dominant and autosomal recessive HIES are linked to a lack of Th17 cell function including the failure to produce the interleukin 17 (IL-17) cytokine (12).  Th17 are a subset of CD4⁺ T helper cells that play an important role in the development of autoimmune diseases like rheumatoid arthritis, as well as being critical in the clearance of fungal and extracellular bacterial infections (13).    

The relatively normal initiation of antibody production by mice with Dock8 mutations suggests that the extrafollicular B cell clonal expansion, plasma cell formation and immunoglobulin class switching, which depends on interactions with T helper cells, is intact.  However, subsequent antibody responses and affinity maturation occurring in the GCs is significantly impaired. The humoral deficits are due to a defect in GC B cell survival and selection during the affinity maturation phase of GC responses (14).

The phenotype of the Guardate mice indicates loss of DOCK8-associated function.

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 411 nucleotides is amplified (chromosome 19, + strand):

1   tgcatgtaca gaacaagacc gatggggaaa aaaaaataca tctagaatta aacttcaccc
61  agaaggatgg tgggccaatg taatagtctc ttcctctccc agtgtagttc cagtccaggg
121 ctaaacagta tggtgtgtgc ctctgctgct cttacaggaa agcgagcagg cagaaaagat
181 caacatcagc cttgccttct tcctgtatga cctcctgtca atcatggaca gaggcttcgt
241 gttcaacctc atcaagcatt actgcagcca ggtgagcgcc ccggagctgc ggctcagccc
301 cttcccaccc actgcttatg tgacagagta ttgccctctt cagtgtgacc ccccacacat
361 cttggacttt caccatctgt agagtgtgcg ggtcctttgg ctaccctgga t

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.