Phenotypic Mutation 'caer' (pdf version)
Allelecaer
Mutation Type missense
Chromosome4
Coordinate65,124,891 bp (GRCm38)
Base Change C ⇒ A (forward strand)
Gene Pappa
Gene Name pregnancy-associated plasma protein A
Synonym(s) IGFBP-4ase, PAPP-A, PAG1, 8430414N03Rik
Chromosomal Location 65,124,174-65,357,509 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are smaller than normal with delayed ossification, but are otherwise normal and fertile. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_021362; MGI:97479

Mapped Yes 
Amino Acid Change Threonine changed to Lysine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000081545]
SMART Domains Protein: ENSMUSP00000081545
Gene: ENSMUSG00000028370
AA Change: T117K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 66 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
LamGL 114 263 1.55e-54 SMART
NL 396 438 4.15e-8 SMART
NL 441 471 6.73e-1 SMART
Pfam:Peptidase_M43 500 657 2.5e-10 PFAM
Blast:FN3 669 929 1e-165 BLAST
CCP 1212 1277 1.39e-9 SMART
CCP 1282 1339 1.08e-6 SMART
CCP 1343 1407 1.64e-6 SMART
CCP 1412 1468 8.06e-6 SMART
NL 1544 1581 3.24e-10 SMART
low complexity region 1584 1591 N/A INTRINSIC
Predicted Effect probably damaging

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
(Using ENSMUST00000084501)
Meta Mutation Damage Score 0.402 question?
Is this an essential gene? Probably essential (E-score: 0.816) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased
Body Weight (BP Male) - decreased
Body Weight (BP) - decreased
Body Weight (Male) - decreased
Motor: Rotarod Weight - decreased 14973274
Candidate Explorer Status CE: excellent candidate; human score: -0.5; ML prob: 0.602
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(4) : Targeted (4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Pappa APN 4 65189316 missense probably damaging 1.00
IGL01340:Pappa APN 4 65323872 missense possibly damaging 0.49
IGL01482:Pappa APN 4 65156034 missense probably benign 0.18
IGL01485:Pappa APN 4 65189299 missense probably damaging 0.96
IGL01759:Pappa APN 4 65205158 splice site probably null
IGL01860:Pappa APN 4 65205092 missense possibly damaging 0.50
IGL01990:Pappa APN 4 65156687 splice site probably benign
IGL02089:Pappa APN 4 65156124 missense possibly damaging 0.75
IGL02153:Pappa APN 4 65297437 missense probably damaging 0.96
IGL02184:Pappa APN 4 65340691 missense possibly damaging 0.82
IGL02324:Pappa APN 4 65196808 missense probably damaging 0.99
IGL02542:Pappa APN 4 65176281 missense probably damaging 1.00
IGL02556:Pappa APN 4 65156626 missense possibly damaging 0.56
IGL02698:Pappa APN 4 65181020 missense probably damaging 1.00
IGL02903:Pappa APN 4 65261980 missense probably damaging 1.00
IGL02974:Pappa APN 4 65204935 missense probably damaging 1.00
IGL03107:Pappa APN 4 65204703 missense probably damaging 1.00
IGL03376:Pappa APN 4 65196834 missense probably benign 0.01
Maennel UTSW 4 65314587 missense probably benign 0.05
maennelein UTSW 4 65314796 splice site probably null
untersuchen UTSW 4 65297257 missense probably damaging 1.00
IGL02980:Pappa UTSW 4 65307774 missense probably benign 0.25
PIT4498001:Pappa UTSW 4 65316232 missense probably damaging 1.00
R0077:Pappa UTSW 4 65307812 missense probably damaging 1.00
R0390:Pappa UTSW 4 65351613 splice site probably null
R0458:Pappa UTSW 4 65155882 missense probably damaging 1.00
R0883:Pappa UTSW 4 65189315 nonsense probably null
R0946:Pappa UTSW 4 65314792 critical splice donor site probably null
R1228:Pappa UTSW 4 65340689 missense probably damaging 1.00
R1327:Pappa UTSW 4 65351603 splice site probably benign
R1489:Pappa UTSW 4 65180948 missense possibly damaging 0.85
R1619:Pappa UTSW 4 65176229 missense probably damaging 1.00
R1856:Pappa UTSW 4 65340743 missense probably damaging 1.00
R2047:Pappa UTSW 4 65231141 splice site probably benign
R2102:Pappa UTSW 4 65316228 nonsense probably null
R2127:Pappa UTSW 4 65297257 missense probably damaging 1.00
R2143:Pappa UTSW 4 65180949 nonsense probably null
R2144:Pappa UTSW 4 65180949 nonsense probably null
R2166:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2167:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2168:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2178:Pappa UTSW 4 65351687 missense probably benign 0.00
R2504:Pappa UTSW 4 65180889 nonsense probably null
R4043:Pappa UTSW 4 65314587 missense probably benign 0.05
R4289:Pappa UTSW 4 65155863 missense probably benign 0.19
R4415:Pappa UTSW 4 65305295 missense probably benign 0.00
R4529:Pappa UTSW 4 65231182 missense probably benign
R4620:Pappa UTSW 4 65327028 missense probably benign 0.43
R4657:Pappa UTSW 4 65314796 splice site probably null
R4658:Pappa UTSW 4 65314796 splice site probably null
R5074:Pappa UTSW 4 65205128 missense probably benign 0.15
R5200:Pappa UTSW 4 65155839 missense probably damaging 1.00
R5420:Pappa UTSW 4 65335780 critical splice donor site probably null
R5469:Pappa UTSW 4 65205152 missense probably benign 0.01
R5651:Pappa UTSW 4 65156352 missense probably damaging 0.99
R5725:Pappa UTSW 4 65189410 missense probably damaging 1.00
R5941:Pappa UTSW 4 65314593 missense possibly damaging 0.52
R6002:Pappa UTSW 4 65297408 missense probably damaging 0.99
R6252:Pappa UTSW 4 65189412 missense probably benign 0.02
R6303:Pappa UTSW 4 65204654 missense probably damaging 1.00
R6322:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6431:Pappa UTSW 4 65156464 missense probably damaging 1.00
R6462:Pappa UTSW 4 65124891 missense probably damaging 0.98
R6484:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6537:Pappa UTSW 4 65297282 missense probably damaging 0.99
R6578:Pappa UTSW 4 65156137 missense possibly damaging 0.48
R6704:Pappa UTSW 4 65204924 missense probably damaging 1.00
R6789:Pappa UTSW 4 65181041 missense probably damaging 1.00
R7023:Pappa UTSW 4 65351718 missense probably benign 0.00
R7139:Pappa UTSW 4 65189450 missense probably benign 0.30
X0058:Pappa UTSW 4 65156232 missense probably damaging 1.00
X0060:Pappa UTSW 4 65124941 missense probably benign 0.00
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-05-22 12:08 PM by Diantha La Vine
Record Created 2018-12-22 5:54 AM by Bruce Beutler
Record Posted 2019-02-27
Phenotypic Description

Figure 1. Caer mice exhibited reduced body weights compared to wild-type littermates. Scaled weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Caer mice exhibited reduced bone mineral content in the tibia.  Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 3. Caer mice exhibited reduced bone mineral densities in the tibia.  Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Caer mice exhibited reduced bone mineral content in the femur.  Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Caer mice exhibited reduced bone mineral densities in the femur.  Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Caer mice exhibited reduced lean mass.  Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The caer phenotype was identified among G3 mice of the pedigree R6462, some of which showed reduced body weights compared to wild-type littermates (Figure 1). Some mice also showed reduced bone mineral content and densities of both tibias (Figure 2 and Figure 3, respectively) and femurs (Figure 4 and Figure 5, respectively). Mice also showed reduced lean mass (Figure 6).

Nature of Mutation

Figure 7. Linkage mapping of the reduced body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 37 mutations (X-axis) identified in the G1 male of pedigree R6462. Weight phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 37 mutations. All of the above anomalies were linked to a mutation in Pappa:  a C to A transversion at base pair 65,124,891 (v38) on chromosome 4, or base pair 718 in the GenBank genomic region NC_000070. The strongest association was found with a recessive model of inheritance to the reduced body weight phenotype, wherein two variant homozygotes departed phenotypically from 19 homozygous reference mice and 37 heterozygous mice with a P value of 1.248 x 10-13 (Figure 7).  

 

The mutation corresponds to residue 718 in the mRNA sequence NM_021362 within exon 1 of 22 total exons.

 

702 CCCCGCGACGCCTTTACACTGCAAGTGTGGCTG

112 -P--R--D--A--F--T--L--Q--V--W--L-

 

The mutated nucleotide is indicated in red. The mutation results in a threonine to lysine substitution at position 117 (T117K) in the PAPPA protein, and is strongly predicted by Polyphen-2 to cause loss of function (score = 0.978).

Protein Prediction
Figure 8. Domain organization of PAPP-A. The caer mutation results in a threonine to lysine substitution at position 117 within the laminin G-like domain. This image is interactive. Other mutations found in PAPP-A are noted in red. Click on each allele for more information. Abbreviations: SP, signal peptide; LNR: Lin12/Notch repeats; CCP, complement control protein

Pappa encodes pregnancy-associated plasma protein A (PAPP-A; alternatively, IGFBP4 protease or differentially expressed in placenta 1 [DIPLA1]), a member of the pappalysin subfamily of the metzincin protease family along with PAPP-A2 (see the record for Lilliputian) and ulilysin. PAPP-A shares 62% homology to PAPP-A2 (1).

 

PAPP-A has several domains, including a signaling peptide (amino acids 1-22), a laminin G-like domain, three Lin12/Notch repeats (LNRs), a metalloprotease region (amino acids 272-583), and five complement control protein (CCP) domains (alternatively, short consensus repeat [SCR] or Sushi domains; amino acids 1210-1279, 1280-1341, 1342-1409, 1410-1470, and 1473-1553) (Figure 8) (2). PAPP-A is initially translated as a 1,624 proprotein; cleavage of the signal peptide and a propeptide (amino acids 23-80) generates the mature 1,544 amino acid peptide (3).

 

Laminin G-like domains are 180 to 200 amino acid modules found in extracellular matrix (ECM) glycoproteins such as laminin, perlecan, and agrin (4). Laminin G-like domains are comprised of a 14-stranded β sandwich with a calcium ion bound to one edge of the sandwich (4). In the above-mentioned ECM proteins, the laminin G-like domains mediate binding to heparin, integrins, and the cell surface receptor α-dystroglycan (α-DG) as well as to sulfated carbohydrates and extracellular ligands (4;5). Association between the laminin G-like domain-containing ECM proteins and heparin or α-DG is essential for basement membrane assembly as well as muscle and nerve cell function. The function of the laminin G-like domain in PAPP-A is unknown.

 

LNRs are typically found only in Notch receptors. LNRs bind calcium and determine proteolytic specificity. The LNRs are approximately 35 to 40 amino acids in length. Each LNR contains six cysteine residues engaged in three disulfide bonds and three conserved aspartate and asparagine residues, which are proposed to coordinate a calcium ion (6). Single amino acid mutations in the PAPP-A LNRs result in loss of calcium binding and subsequent loss of activity towards insulin-like growth factor binding protein 4 (IGFBP4), a PAPP-A substrate; cleavage of another substrate, IGFBP5, was not disrupted (7).

 

The CCP domains have a consensus sequence spanning approximately 60 residues containing four invariant cysteine residues forming two disulfide-bridges (I-III and II-IV), a highly conserved tryptophan, and conserved glycine, proline, and hydrophobic residues (8). CCP domains fold into a small and compact hydrophobic core enveloped by six beta-strands and stabilized by the disulfide bridges; the topology of the other strands relative to this central conserved core is variable (9;10). The CCP domains mediate recognition processes such as the binding of complement factors to fragments C3b and C4b (8). The third and fourth CCP domains of PAPP-A bind cell surface molecules displaying glycosaminoglycans (GAGs).

 

PAPP-A has 14 putative N-glycosylation sites, seven putative O-glycosylation sites, and 82 cysteines that are involved in disulfide bond formation (2). PAPP-A forms a disulfide-linked homodimer, and is found as a disulfide-linked 2:2 heterotetramer with the proform of PRG2 (proMBP) in pregnancy serum. Formation of the PAPP-A/proMBP complex results in rearrangement of disulfide bonds in proximity to the PAPP-A active site, which renders PAPP-A inactive towards its substrates (11-13).

 

Human PAPPA produces a major transcript of approximately 12-kb and a minor transcript of approximately 8.5 kb in the placenta (2). A short transcript, designated DIPLA1, and a DIPLA1 antisense transcript, DIPAS, was cloned from the 3-prime end of PAPPA (14). DIPLA1 and DIPAS are encoded by one exon and contain several upstream open reading frames. DIPLA1 is expressed only in the placenta (14).

 

The caer mutation results in a threonine to lysine substitution at position 117 (T117K); Thr117 is within the laminin G-like domain.

Expression/Localization

PAPPA is predominantly expressed in the placenta (2). PAPP-A is expressed in ovarian follicles, follicular fluid, luteal cells, and fallopian tubes of nonpregnant women and in the seminal vesicles and seminal fluid of males. PAPP-A is also expressed in the kidney, spleen, breast, brain, skin, and prostate (15).

 

Serum PAPP-A levels are often increased in patients with severe sepsis and may be associated with sepsis-related myocardial dysfunction (16). Maternal serum levels of PAPP-A increases exponentially until term. Women with low PAPP-A expression levels during their first trimester were more likely to have a child born small (£10th percentile) for their gestational age (17-22).

Background
Figure 9. PAPP-A functions in the processing of IGFBP4. In IGF-1R-associated signaling, the MAPK and Akt/mTOR pathways are essential for cell proliferation, differentiation, protein synthesis, cell survival, and metabolism. PI3K signals mTORC1 via Akt, which inactivates TSC to prevent inibition of mTORC1. mTORC1 mediates several downstream effects in the cell including suppression of autophagy, activation of transcription leading to mitochondrial metabolism, increased protein synthesis, proliferation, and growth factor production.

PAPP-A is a secreted metalloproteinase that cleaves IGFBP2, IGFBP4, and IGFBP5. PAPP-A cleaves the Met135/Lys136 bond in IGFBP4 and the Ser143/Lys144 bond in IGFBP5 (23-26). IGFBPs are carrier proteins that bind insulin-like growth factors (IGFs), regulating the bioavailability of IGFs by prolonging their half-life and circulation turnover. IGFBP5 is a factor involved in bone metabolism, and also has IGF-I-independent functions. IGFPB5 is able to bind its putative receptor, facilitating its entry into the cytoplasm and subsequent interaction with other proteins. IGF release and IGF-related signaling is mediated by the cleavage of the IGFBPs by proteases (Figure 9). IGFs are essential for the regulation of growth and development by influencing the proliferation, differentiation, and apoptosis of osteoblasts (23;27). IGFs bind to two types of receptors (IGF-IR and IGF-IIR), subsequently activating downstream tyrosine kinase pathways. In IGF-I-associated signaling, both the IRS-1/phosphoinositide 3-kinase/serine–threonine kinase pathway and the Ras/mitogen-activated protein kinase/extracellular signal-regulated kinase pathway are activated, which subsequently promote cell proliferation, tissue differentiation, and protection from apoptosis.

 

Pappa-deficient (Pappa-/-) mice showed reduced body sizes and weights (60 to 70% of wild-type mice) as well as delayed bone ossification (28). The Pappa-/- mice also showed increased lifespans by 30 to 40% as well as reduced incidences of spontaneous tumors (29). Pappa-/- mice had resistance to age-dependent thymic involution (30), and Pappa-/- female mice showed reduced ovarian function and fertility (31). In contrast, transgenic overexpression of PAPP-A in skeletal muscle resulted in increased skeletal muscle weight and muscle fiber area (32). Mice with transgenic overexpression of PAPP-A in osteoblasts showed increased calvarial bone thickness, bone marrow cavities, skull bone mineral densities, total bone area in the femur and tibia, and bone formation rates (33). Osteoblasts from mice with transgenic overexpression of PAPP-A in osteoblasts showed increased IGFBP4 proteolysis and free IGF-I concentration (33).

Putative Mechanism

Through its role in cleaving IGFBPs (and subsequent release of bioactive IGF), PAPP-A functions as a growth-promoting enzyme. IGFBP4 cleavage is required to activate most, if not all, IGF2-mediated growth-promoting activity. The reduced body size phenotype of the Pappa-/- mice is similar to that in IGF2 knockout mice (34) and IGFBP4 knockout mice (35). The phenotype of the caer mice mimics that of the Pappa-/- mice, indicating loss of PAPP-A function.

Primers PCR Primer
caer(F):5'- TTGCCAACCAGGAGGAGTTG -3'
caer(R):5'- CCATTCCGCAGATGGGTTAAAG -3'

Sequencing Primer
caer_seq(F):5'- ACATGCGGCTCTGGAGTTG -3'
caer_seq(R):5'- CAGATGGGTTAAAGAGAGTCTCTC -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsNanda Regmi, Jonathan Rios, and Bruce Beutler