Phenotypic Mutation 'curveball2' (pdf version)
Allelecurveball2
Mutation Type nonsense
Chromosome10
Coordinate79,733,773 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Hcn2
Gene Name hyperpolarization-activated, cyclic nucleotide-gated K+ 2
Synonym(s) HAC1, trls
Chromosomal Location 79,716,634-79,736,108 bp (+)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a hyperpolarization-activated cation channel involved in the generation of native pacemaker activity in the heart and in the brain. The encoded protein is activated by cAMP and can produce a fast, large current. Defects in this gene were noted as a possible cause of some forms of epilepsy. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for mutant alleles exhibit decreased body weight, behavioral/neurological abnormalities, and tremors or absence seizures. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_008226; MGI:1298210

Mapped Yes 
Amino Acid Change Glutamic Acid changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000020581] [ENSMUSP00000097113]
PDB Structure
HCN2J 443-645 in the presence of cGMP [X-RAY DIFFRACTION]
HCN2I 443-640 in the presence of cAMP, selenomethionine derivative [X-RAY DIFFRACTION]
HCN2J 443-645 in the presence of cAMP, selenomethionine derivative [X-RAY DIFFRACTION]
Structure and rearrangements in the carboxy-terminal region of SpIH channels [X-RAY DIFFRACTION]
HCN2-I 443-460 E502K in the presence of cAMP [X-RAY DIFFRACTION]
X-ray structure of cysteine-free fragment of mHCN2 C-terminal region from amino acids 443-630 including C508N, C584S, and C601S mutations [X-RAY DIFFRACTION]
HCN2I 443-640 apo-state [X-RAY DIFFRACTION]
Trip8b-1a#206-567 interacting with the carboxy-terminal seven residues of HCN2 [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000020581
Gene: ENSMUSG00000020331
AA Change: E536*

DomainStartEndE-ValueType
low complexity region 4 47 N/A INTRINSIC
low complexity region 106 128 N/A INTRINSIC
Pfam:Ion_trans_N 140 183 5e-23 PFAM
Pfam:Ion_trans 184 447 3.3e-24 PFAM
low complexity region 448 459 N/A INTRINSIC
Blast:cNMP 460 492 9e-13 BLAST
cNMP 517 630 4.79e-22 SMART
low complexity region 727 765 N/A INTRINSIC
low complexity region 778 800 N/A INTRINSIC
low complexity region 804 838 N/A INTRINSIC
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000097113
Gene: ENSMUSG00000020331
AA Change: E536*

DomainStartEndE-ValueType
low complexity region 4 47 N/A INTRINSIC
low complexity region 106 128 N/A INTRINSIC
Pfam:Ion_trans_N 139 215 2.6e-47 PFAM
Pfam:Ion_trans 219 435 1.5e-20 PFAM
low complexity region 448 459 N/A INTRINSIC
Blast:cNMP 460 492 9e-13 BLAST
cNMP 517 630 4.79e-22 SMART
low complexity region 727 765 N/A INTRINSIC
low complexity region 778 800 N/A INTRINSIC
low complexity region 804 838 N/A INTRINSIC
Predicted Effect probably null
Meta Mutation Damage Score 0.664 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Body Weight - decreased
Body Weight (BP Male) - decreased
Body Weight (BP) - decreased
Body Weight (BP, z-score) - decreased
Body Weight (Male) - decreased
Body Weight (Z-score) - decreased
FACS B cells - decreased
FACS CD4:CD8 - increased
Motor: Rotarod Weight - decreased
Motor: Rotarod Weight (Z-score) - decreased
Candidate Explorer Status CE: excellent candidate; human score: 2.5; ML prob: 0.85
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(9) : Chemically induced (other)(1) Spontaneous(3) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Hcn2 APN 10 79733803 nonsense probably null
IGL01339:Hcn2 APN 10 79729068 missense probably damaging 1.00
IGL02183:Hcn2 APN 10 79724813 critical splice donor site probably null
asombrarse UTSW 10 79724611 missense probably damaging 1.00
curveball UTSW 10 79724786 missense probably damaging 1.00
mire UTSW 10 79729113 critical splice donor site probably null
R0269:Hcn2 UTSW 10 79734241 unclassified probably benign
R0671:Hcn2 UTSW 10 79734232 splice site probably null
R1879:Hcn2 UTSW 10 79726189 missense probably benign 0.03
R1913:Hcn2 UTSW 10 79730943 missense probably benign 0.14
R4051:Hcn2 UTSW 10 79733687 unclassified probably null
R4052:Hcn2 UTSW 10 79733687 unclassified probably null
R4328:Hcn2 UTSW 10 79724611 missense probably damaging 1.00
R4507:Hcn2 UTSW 10 79724786 missense probably damaging 1.00
R4518:Hcn2 UTSW 10 79724702 missense probably benign 0.17
R4578:Hcn2 UTSW 10 79724448 synonymous probably null
R5334:Hcn2 UTSW 10 79726291 missense probably damaging 0.99
R5788:Hcn2 UTSW 10 79717111 missense possibly damaging 0.48
R6131:Hcn2 UTSW 10 79733908 missense probably damaging 1.00
R6457:Hcn2 UTSW 10 79733773 nonsense probably null
R6547:Hcn2 UTSW 10 79717152 missense probably benign 0.29
R6851:Hcn2 UTSW 10 79729113 critical splice donor site probably null
R7276:Hcn2 UTSW 10 79729100 missense possibly damaging 0.95
X0024:Hcn2 UTSW 10 79734120 missense probably damaging 1.00
Mode of Inheritance Unknown
Local Stock
Repository
Last Updated 2019-09-04 9:33 PM by Diantha La Vine
Record Created 2018-11-26 8:01 PM by Emre Turer
Record Posted 2018-12-10
Phenotypic Description

Figure 1. Curveball2 mice exhibited reduced body weights compared to wild-type littermates. Scaled body weights are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Curveball2 mice exhibited aberrant motor coordination. Motor coordination was assessed by rotarod test. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The curveball2 phenotype was identified among G3 mice of the pedigree R6457, some of which showed reduced body weights compared to wild-type littermates (Figure 1). The mice also showed aberrant motor coordination as assessed by the rotarod test (Figure 2).

Nature of Mutation

Figure 3. Linkage mapping of the reduced body weights using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 68 mutations (X-axis) identified in the G1 male of pedigree R6457. Weight data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 68 mutations. All of the above anomalies were linked by continuous variable mapping to mutations in two genes on chromosome 10: Hcn2 and Prdm4. The mutation in Hcn2 was presumed causative as the phenotypes in the curveball2 mimicked that of other Hcn2 mutant mouse models [see curveball and (1;2)]. The mutation in Hcn2 is a G to T transversion at base pair 79,733,773 (v38) on chromosome 10, or base pair 17,140 in the GenBank genomic region NC_000076 encoding Hcn2. The strongest association was found with a recessive model of inheritance to the body weight phenotype, wherein one variant homozygote departed phenotypically from 10 homozygous reference mice and 16 heterozygous mice with a P value of 7.949 x 10-11 (Figure 3).  

 

The mutation corresponds to residue 1,641 in the mRNA sequence NM_008226 within exon 6 of 8 total exons.


 

1626 ACAAAGCTCAAATTTGAGGTCTTCCAGCCTGGA

531  -T--K--L--K--F--E--V--F--Q--P--G-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of glutamic acid 536 for a premature stop codon (E536*) in the HCN2 protein.

Protein Prediction
Figure 4. Domain organization and topology of mouse HCN2. HCN2 has six transmembrane domains and cytoplasmic N- and C-termini. The ion-conducting pore region is between transmembrane domains 5 and 6. The HCN2 C-terminus has two domains: a C-linker domain and the cyclic nucleotide-binding domain (CNBD). The curveball2 mutation results  substitution of glutamic acid 536 for a premature stop codon (E536*). This image is interactive. Other mutations found in HCN2 are noted in red. Click on each muation for more information.

Hcn2 encodes hyperpolarization-activated cyclic nucleotide-gated (HCN) channel 2 (HCN2). The HCN channels (i.e., HCN1, HCN2, HCN3, and HCN4) are members of the voltage-gated potassium ion channel superfamily present mainly in neurons and heart cells (3). The HCN channels are complexes of four HCN subunits arranged around the central pore; the HCN proteins can form homomeric or heteromeric channels with other members of the HCN family (4-6).

 

HCN2 has six transmembrane domains and cytoplasmic N- and C-termini. Transmembrane domain 4 is a positively-charged voltage sensor. The ion-conducting pore region is between transmembrane domains 5 and 6. The HCN2 C-terminus has two domains: a C-linker domain composed of six α-helices separated by short loops and the CNBD. The C-linker domain connects the CNBD to the transmembrane domains.  The CNBD mediates modulation by cyclic nucleotides (e.g., cyclic adenosine monophosphate [cAMP]) (7).

 

The curveball2 mutation results in substitution of glutamic acid 536 for a premature stop codon (E536*); Glu536 is within the cytoplasmic C-terminal tail preceding the CNBD.

 

Please see the record curveball for more information about Hcn2.

Putative Mechanism

HCN2 is a regulator of nociceptor excitability. In nociceptive neurons, HCN2 modulates the generation of action potentials in response to inflammation. For example, upon prostaglandin E2 (PGE2) binding to a G protein-coupled receptor coupled to Gs, adenylate cyclase is activated, which elevates cAMP. The elevation of cAMP shifts the activation curve of HCN2 in the positive direction, which causes a HCN2-dependent tonic inward current (termed Ih) to be activated at the resting potential. The Ih current is essential for cardiac and neuronal pacemaker activity, dendritic integration of synaptic transmission, and the setting of resting potentials (8).

 

Loss-of-function mutations in HCN2 have been linked to idiopathic generalized epilepsies in patients (9;10). In addition, gain-of-function mutations are linked to polygenic epilepsy (11). Mutations in HCN2 have been correlated with increased incidence of febrile seizures (12). The mutant HCN2 channels exhibited faster kinetics with higher temperatures and subsequent increased rate of availability of the current.

 

Hcn2-deficient (Hcn2-/-) mice were hypoactive and smaller than their wild-type littermates (1;2;13). The Hcn2-/- mice exhibited absence epilepsy, ataxia, and sinus arrhythmia (13). Hcn2-/- mice also showed impaired balance and coordination (1;2).

 

The reduced size and the impaired coordination phenotypes observed in the curveball2 mice indicates a loss of HCN2-associated function.

Primers PCR Primer
curveball2(F):5'- AAAGTTCATCTGGTCCTGCC -3'
curveball2(R):5'- ATCCAGATCTCAGCCTTGCC -3'

Sequencing Primer
curveball2_seq(F):5'- TGAGGGTTCACCAAGTAGCC -3'
curveball2_seq(R):5'- AGATCTCAGCCTTGCCACAGG -3'
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 410 nucleotides is amplified (chromosome 10, + strand):


1   aaagttcatc tggtcctgcc tccagcgtcc gcctgggaag ttagataggg gctgagggtt
61  caccaagtag cccagaggaa agtgggggtc tgagttacca agccagtcac tgagccaccc
121 tccctcccac ccacaggaga ttgtgaactt caactgccgg aagctggtgg cttccatgcc
181 gctgtttgcc aatgcagacc ccaacttcgt cacagccatg ctgacaaagc tcaaatttga
241 ggtcttccag cctggagatt acatcatccg agaggggacc atcgggaaga agatgtactt
301 catccagcat ggggtggtga gcgtgctcac caagggcaac aaggagatga agctgtcgga
361 tggctcctat ttcgggggtg agcaccctgt ggcaaggctg agatctggat 


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsSohini Mukherjee, Zhao Zhang, and Bruce Beutler