The quake phenotype was identified among G3 mice of the pedigree R6335, some of which showed ataxia that progressed into rear limb paralysis (Figure 1).

Whole exome HiSeq sequencing of the G1 grandsire identified 60 mutations. The behavioral/neurological phenotype was linked to a mutation in Galc: an A to G transition at base pair 98,242,714 (v38) on chromosome 12, or base pair 16,750 in the GenBank genomic region NC_000078 encoding Galc. Linkage was found with a recessive model of inheritance, wherein eight affected mice were homozygous for the variant allele, and 10 unaffected mice were either heterozygous (N = 7) or homozygous for the reference allele (N = 3) with a P value of 01000145 (Figure 2).

The mutation corresponds to residue 810 in the NM_008079 mRNA sequence in exon 7 of 17 total exons.

794 AGAATCATAGCGAGCGATAATCTCTGGGAGCCG

The mutated nucleotide is indicated in red. The mutation results in an aspartic acid to glycine substitution at position 227 (D227G) in the GALC protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Galc encodes GALC (galactosylceramidase; alternatively, galactocerebrosidase), a member of carbohydrate-active enzymes glycoside hydrolase family 59 (GH59) (1). GALC is a 684-amino acid peptide that has a signal peptide (amino acids 1-24) followed by a triosephosphate isomerase (TIM) barrel (amino acids 41-337), a β-sandwich domain, and a lectin domain (amino acids 572-668) (Figure 3) (1). GALC is an approximately 80 kDa precursor protein. In lysosomes, GALC is processed into two fragments: a 50 kDa N-terminal fragment and a 30 kDa C-terminal fragment (2). The processed protein fragments stabilize the 80 kDa protein, which is the enzymatically active form of the protein (2;3).

The structure of residues 25 to 668 of mouse GALC has been solved (Figure 4; PDB:3ZR6; (1)). Amino acids 25 to 40 comprise two β-strands of the β-sandwich domain before forming the TIM barrel; amino acids 338 to 452 are the remainder of the β-sandwich domain. The lectin domain has a similar fold and calcium-binding site as to other glycosyl hydrolayses, including β-glucanase and galectin. However, the GALC lectin domain does not have the catalytic residues found in the β-glucanase family. Residues from the TIM barrel, β-sandwich domain, and lectin domain contribute to the substrate-binding pocket.

The quake mutation results in an aspartic acid to glycine substitution at position 227 (D227G); D56 is within the TIM.

Please see the record Crabby2 for more information about Galc.

GALC is a lysosomal enzyme that hydrolyzes galactosylceramide, psychosine, monogalactosyldiglyceride, and possibly lactosylceramide. Galactosylceramide, psychosine, and monogalactosyldiglyceride are essential for myelination in the nervous system; galactosylceramide is a major component of myelin.

The twitcher mouse model has a spontaneous mutation in Galc that results in nonsense-mediated decay of the Galc transcript (4;5). The twitcher mice are phenotypically normal until approximately postnatal day 20 after which they exhibit progressive neurological phenothypes, including tremors, hindlimb weakness. The twitcher mice also exhibit slowed weight gain and wasting; most mice die by postnatal day 40 (6;7). The twitcher mice exhibit nervous system gliosis, myelin loss in both the peripheral and central nervous systems, and macrophage accumulation, similar to that observed in human Krabbe disease patients (see below) (6;7). The UDP-galactose:ceramide galactosyltransferase activity was normal in the spinal cord of the twitcher mice at postnatal day 15 (8). After postnatal day 15, there was a progressive loss in the galactosyltransferase activity (8). Galactosyltransferase activity remained normal in the kidney at all times examined. The twitcher mice have reduced frequencies of early hematopoietic progenitors and defects in the hematopoietic niche (9).

A second spontatneous Galc mutation (Galc^twi-5J) resulting in a glutamic acid to lysine conversion at amino acid 130 causes weakness, stunted weight gain, and generalized tremors after two weeks of age; the Galc^twi-5J mice die by approximately four weeks of age (10). The Galc^twi-5J mice have gliosis, globoid cells, and psychosine accumulation in the nervous system, but the central nervous system does not exhibit significant demyelination. The peripheral nervous system is hypomyelinated and does not have large diameter axons, indicating primary dysmyelination instead of demyelination.

Galc-deficient (Galc^-/-) mice feed normally and exhibit similar rates of growth to wild-type mice 30 days after birth (11). At approximately postnatal day 25 to 30, the Galc^-/- mice exhibit tremors and hind leg weakness. The Galc^-/- mice are slightly larger than the twitcher mice. The Galc^-/- mice gain weight until postnatal day 35 to 40, and then they show progressive weight loss. On average, the Galc^-/- mice exhibit lethality at approximately postnatal day 50 to 55. Near the time of death, the Galc^-/- mice typically exhibit hind limb paralysis and severe hind limb wasting.

In humans, mutations in GALC lead to global-cell leukodystrophy (GLD; alternatively, Krabbe disease; OMIM: #245200) (12). In most cases, Krabbe disease manifests within the first six months of life, but other Krabbe patients present symptoms later, even into adulthood (13). Krabbe patients exhibit mental retardation and developmental delay due to widespread demyelination; infant Krebbe patients often die by two years of age (14-16). Krabbe disease is the results of low GALC enzyme activity and a reduced ability to degrade galactolipids in myelin (13). Patients with Krabbe disease have decreased myelin due to the presence of psychosine, which is cytotoxic to oligodendroyctes, and the accumulation of galactosylceramide (13).

The neurological phenotype observed in the quake mice indicates loss of GALC-associated function.

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold

The following sequence of 401 nucleotides is amplified (chromosome 12, - strand):

1   atgcctccac tgcattatgc cggacaccca gtcctctgag aagcagtgcg gatattatcg
61  ttagaatgta gaattctgaa agatacgctg gctattttgg tcatattcca gtagctaaag
121 gctcacttgt aacctttgct gtgtcctgtt tatgtctccc aaggaattaa gaaaaatgct
181 ggattatcaa ggtctccagc gagtgagaat catagcgagc gataatctct gggagccgat
241 ttcctcttcc ttgctgctgg accaggaact ctggaaggtg gttgatgtta tagggtaagg
301 tgcgatttac tttgaccacc aacagtttgt ggtttcttta ccctggtgtt aactgtgcat
361 ttcttcttgc cctctctgcc cctggattac actcctatgg c

Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.