Phenotypic Mutation 'quake' (pdf version)
Allelequake
Mutation Type missense
Chromosome12
Coordinate98,242,714 bp (GRCm38)
Base Change T ⇒ C (forward strand)
Gene Galc
Gene Name galactosylceramidase
Synonym(s) Gacy, A930008M05Rik, 2310068B06Rik, galactocerebrosidase
Chromosomal Location 98,202,294-98,259,459 bp (-)
MGI Phenotype FUNCTION: This gene encodes galactosylceramidase, the lysosomal hydryolase involved in the catabolism of galactosylceramide. Mutations in this gene result in slow growth, tremors and hind leg weakness, collectively termed as the 'twitcher' phenotype. In humans, deficiency of this gene product causes a lysosomal storage disorder known as Krabbe disease. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for spontaneous and targeted mutations exhibit tremors, progressive weakness, wasting, both central and peripheral demyelination, massive accumulation of galactosylceramide, abnormal macrophages, and death by 4 months of age. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_008079; MGI:95636

Mapped Yes 
Amino Acid Change Aspartic acid changed to Glycine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000021390]
PDB Structure
STRUCTURE OF GALACTOCEREBROSIDASE FROM MOUSE [X-RAY DIFFRACTION]
STRUCTURE OF GALACTOCEREBROSIDASE FROM MOUSE IN COMPLEX WITH GALACTOSE [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE GALACTOCEREBROSIDASE WITH 4NBDG: ENZYME-SUBSTRATE COMPLEX [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE GALACTOCEREBROSIDASE WITH D-GALACTAL: ENZYME- INTERMEDIATE COMPLEX [X-RAY DIFFRACTION]
STRUCTURE OF MOUSE GALACTOCEREBROSIDASE WITH GALACTOSE: ENZYME- PRODUCT COMPLEX [X-RAY DIFFRACTION]
SMART Domains Protein: ENSMUSP00000021390
Gene: ENSMUSG00000021003
AA Change: D227G

DomainStartEndE-ValueType
Pfam:Glyco_hydro_59 17 684 N/A PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000021390)
Predicted Effect unknown
Meta Mutation Damage Score 0.498 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
behavior/neurological
Candidate Explorer Status CE: failed initial filter
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(13) : Chemically induced (ENU)(3) Chemically induced (other)(1) Spontaneous(4) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Galc APN 12 98231422 missense probably benign
IGL01287:Galc APN 12 98246244 unclassified probably benign
IGL01618:Galc APN 12 98252081 missense possibly damaging 0.92
IGL02125:Galc APN 12 98231509 missense probably damaging 1.00
IGL02274:Galc APN 12 98254214 nonsense probably null
IGL02392:Galc APN 12 98207413 missense probably damaging 0.99
IGL02478:Galc APN 12 98213132 missense possibly damaging 0.96
IGL02544:Galc APN 12 98231442 missense probably benign 0.27
IGL03268:Galc APN 12 98222593 splice site probably benign
IGL03327:Galc APN 12 98207476 splice site probably benign
Crabby2 UTSW 12 98234266 missense probably damaging 1.00
Krabbe UTSW 12 98222647 missense probably damaging 1.00
teeter UTSW 12 98259162 missense probably damaging 1.00
R0218:Galc UTSW 12 98222647 missense probably damaging 1.00
R0240:Galc UTSW 12 98252034 missense probably damaging 1.00
R0240:Galc UTSW 12 98252034 missense probably damaging 1.00
R0467:Galc UTSW 12 98242645 missense probably damaging 1.00
R1619:Galc UTSW 12 98234304 missense probably benign 0.00
R1763:Galc UTSW 12 98234266 missense probably damaging 1.00
R1832:Galc UTSW 12 98234240 critical splice donor site probably null
R1844:Galc UTSW 12 98246297 unclassified probably null
R1996:Galc UTSW 12 98252026 missense probably damaging 1.00
R2010:Galc UTSW 12 98254230 missense possibly damaging 0.51
R2097:Galc UTSW 12 98252032 missense probably benign
R2496:Galc UTSW 12 98227281 missense probably damaging 1.00
R2881:Galc UTSW 12 98213096 missense probably benign
R3009:Galc UTSW 12 98203969 missense probably damaging 1.00
R4571:Galc UTSW 12 98222617 missense probably benign 0.00
R4764:Galc UTSW 12 98242744 missense possibly damaging 0.78
R4851:Galc UTSW 12 98227274 missense probably benign 0.00
R4854:Galc UTSW 12 98256877 missense probably damaging 1.00
R4900:Galc UTSW 12 98231472 missense probably damaging 1.00
R4983:Galc UTSW 12 98242768 nonsense probably null
R5220:Galc UTSW 12 98231413 splice site probably null
R5273:Galc UTSW 12 98252071 missense probably damaging 1.00
R5495:Galc UTSW 12 98231414 critical splice donor site probably null
R5689:Galc UTSW 12 98212986 missense possibly damaging 0.94
R5819:Galc UTSW 12 98216261 missense probably benign 0.06
R6191:Galc UTSW 12 98252034 missense probably damaging 1.00
R6196:Galc UTSW 12 98259162 missense probably damaging 1.00
R6305:Galc UTSW 12 98259290 missense possibly damaging 0.57
R6335:Galc UTSW 12 98242714 missense probably damaging 1.00
R7255:Galc UTSW 12 98246255 missense probably null 0.84
Mode of Inheritance Unknown
Local Stock Live Mice
Repository
Last Updated 2019-09-04 9:34 PM by Anne Murray
Record Created 2018-07-27 10:36 AM by Jamie Russell
Record Posted 2019-05-08
Phenotypic Description
Figure 1. Quake mice exhibited ataxia and hind limb paralysis.

The quake phenotype was identified among G3 mice of the pedigree R6335, some of which showed ataxia that progressed into rear limb paralysis (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the ataxia/paralysis phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 60 mutations (X-axis) identified in the G1 male of pedigree R6335. Binary data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 60 mutations. The behavioral/neurological phenotype was linked to a mutation in Galc: an A to G transition at base pair 98,242,714 (v38) on chromosome 12, or base pair 16,750 in the GenBank genomic region NC_000078 encoding Galc. Linkage was found with a recessive model of inheritance, wherein eight affected mice were homozygous for the variant allele, and 10 unaffected mice were either heterozygous (N = 7) or homozygous for the reference allele (N = 3) with a P value of 01000145 (Figure 2).

 

The mutation corresponds to residue 810 in the NM_008079 mRNA sequence in exon 7 of 17 total exons.

 

794 AGAATCATAGCGAGCGATAATCTCTGGGAGCCG

222 -R--I--I--A--S--D--N--L--W--E--P-


 

The mutated nucleotide is indicated in red. The mutation results in an aspartic acid to glycine substitution at position 227 (D227G) in the GALC protein, and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 3. Domain organization of mouse GALC. GALC is a 684-amino acid peptide that has a signal peptide (amino acids 1-24) followed by a triosephosphate isomerase (TIM) barrel (amino acids 41-337), a β-sandwich domain, and a lectin domain (amino acids 572-668). The quake mutation results in an aspartic acid to glycine substitution at position 227 (D227G) in the GALC protein. This image is interactive. Other mutations found in GALC are noted in red. Click on the mutations for more specific information.
Figure 4. Crystal structure of mouse GALC. Residues 25 to 668 were solved. The locations of the domains shown in Figure 6 are indicated. The figure is interactive; click to rotate. Figure was generated by UCSF Chimera and is based on Dean et al. (2011). PDB:3ZR6.

Galc encodes GALC (galactosylceramidase; alternatively, galactocerebrosidase), a member of carbohydrate-active enzymes glycoside hydrolase family 59 (GH59) (1). GALC is a 684-amino acid peptide that has a signal peptide (amino acids 1-24) followed by a triosephosphate isomerase (TIM) barrel (amino acids 41-337), a β-sandwich domain, and a lectin domain (amino acids 572-668) (Figure 3) (1). GALC is an approximately 80 kDa precursor protein. In lysosomes, GALC is processed into two fragments: a 50 kDa N-terminal fragment and a 30 kDa C-terminal fragment (2). The processed protein fragments stabilize the 80 kDa protein, which is the enzymatically active form of the protein (2;3).

 

The structure of residues 25 to 668 of mouse GALC has been solved (Figure 4; PDB:3ZR6; (1)). Amino acids 25 to 40 comprise two β-strands of the β-sandwich domain before forming the TIM barrel; amino acids 338 to 452 are the remainder of the β-sandwich domain. The lectin domain has a similar fold and calcium-binding site as to other glycosyl hydrolayses, including β-glucanase and galectin. However, the GALC lectin domain does not have the catalytic residues found in the β-glucanase family. Residues from the TIM barrel, β-sandwich domain, and lectin domain contribute to the substrate-binding pocket.

 

The quake mutation results in an aspartic acid to glycine substitution at position 227 (D227G); D56 is within the TIM.

 

Please see the record Crabby2 for more information about Galc.

Putative Mechanism

GALC is a lysosomal enzyme that hydrolyzes galactosylceramide, psychosine, monogalactosyldiglyceride, and possibly lactosylceramide. Galactosylceramide, psychosine, and monogalactosyldiglyceride are essential for myelination in the nervous system; galactosylceramide is a major component of myelin.

 

The twitcher mouse model has a spontaneous mutation in Galc that results in nonsense-mediated decay of the Galc transcript (4;5). The twitcher mice are phenotypically normal until approximately postnatal day 20 after which they exhibit progressive neurological phenothypes, including tremors, hindlimb weakness. The twitcher mice also exhibit slowed weight gain and wasting; most mice die by postnatal day 40 (6;7). The twitcher mice exhibit nervous system gliosis, myelin loss in both the peripheral and central nervous systems, and macrophage accumulation, similar to that observed in human Krabbe disease patients (see below) (6;7). The UDP-galactose:ceramide galactosyltransferase activity was normal in the spinal cord of the twitcher mice at postnatal day 15 (8). After postnatal day 15, there was a progressive loss in the galactosyltransferase activity (8). Galactosyltransferase activity remained normal in the kidney at all times examined. The twitcher mice have reduced frequencies of early hematopoietic progenitors and defects in the hematopoietic niche (9).

 

A second spontatneous Galc mutation (Galctwi-5J) resulting in a glutamic acid to lysine conversion at amino acid 130 causes weakness, stunted weight gain, and generalized tremors after two weeks of age; the Galctwi-5J mice die by approximately four weeks of age (10). The Galctwi-5J mice have gliosis, globoid cells, and psychosine accumulation in the nervous system, but the central nervous system does not exhibit significant demyelination. The peripheral nervous system is hypomyelinated and does not have large diameter axons, indicating primary dysmyelination instead of demyelination.

 

Galc-deficient (Galc-/-) mice feed normally and exhibit similar rates of growth to wild-type mice 30 days after birth (11). At approximately postnatal day 25 to 30, the Galc-/- mice exhibit tremors and hind leg weakness. The Galc-/- mice are slightly larger than the twitcher mice. The Galc-/- mice gain weight until postnatal day 35 to 40, and then they show progressive weight loss. On average, the Galc-/- mice exhibit lethality at approximately postnatal day 50 to 55. Near the time of death, the Galc-/- mice typically exhibit hind limb paralysis and severe hind limb wasting.

 

In humans, mutations in GALC lead to global-cell leukodystrophy (GLD; alternatively, Krabbe disease; OMIM: #245200) (12). In most cases, Krabbe disease manifests within the first six months of life, but other Krabbe patients present symptoms later, even into adulthood (13). Krabbe patients exhibit mental retardation and developmental delay due to widespread demyelination; infant Krebbe patients often die by two years of age (14-16). Krabbe disease is the results of low GALC enzyme activity and a reduced ability to degrade galactolipids in myelin (13). Patients with Krabbe disease have decreased myelin due to the presence of psychosine, which is cytotoxic to oligodendroyctes, and the accumulation of galactosylceramide (13).

 

The neurological phenotype observed in the quake mice indicates loss of GALC-associated function.

Primers PCR Primer
quake(F):5'- GCCATAGGAGTGTAATCCAGG -3'
quake(R):5'- ATGCCTCCACTGCATTATGC -3'

Sequencing Primer
quake_seq(F):5'- CATAGGAGTGTAATCCAGGGGCAG -3'
quake_seq(R):5'- CTCTGAGAAGCAGTGCGGATATTATC -3'
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 401 nucleotides is amplified (chromosome 12, - strand):


1   atgcctccac tgcattatgc cggacaccca gtcctctgag aagcagtgcg gatattatcg
61  ttagaatgta gaattctgaa agatacgctg gctattttgg tcatattcca gtagctaaag
121 gctcacttgt aacctttgct gtgtcctgtt tatgtctccc aaggaattaa gaaaaatgct
181 ggattatcaa ggtctccagc gagtgagaat catagcgagc gataatctct gggagccgat
241 ttcctcttcc ttgctgctgg accaggaact ctggaaggtg gttgatgtta tagggtaagg
301 tgcgatttac tttgaccacc aacagtttgt ggtttcttta ccctggtgtt aactgtgcat
361 ttcttcttgc cctctctgcc cctggattac actcctatgg c


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsLauren Prince, Brittney Roy, Dana Smith, Jamie Russell, and Bruce Beutler