Allele | salt_and_pepper | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | intron (3 bp from exon) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 13 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 44,941,438 bp (GRCm38) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | T ⇒ A (forward strand) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Dtnbp1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | dystrobrevin binding protein 1 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonym(s) | 5430437B18Rik, sdy, dysbindin, Bloc1s8 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 45,075,552-45,155,614 bp (-) (GRCm39) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. A similar protein in mouse is a component of a protein complex termed biogenesis of lysosome-related organelles complex 1 (BLOC-1), and binds to alpha- and beta-dystrobrevins, which are components of the dystrophin-associated protein complex (DPC). Mutations in this gene are associated with Hermansky-Pudlak syndrome type 7. This gene may also be associated with schizophrenia. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] PHENOTYPE: Mutations at this locus result in pigmentation anomalies of the coat and eye as well as prolonged bleeding times due to platelet abnormalities. [provided by MGI curators] |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | not available | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | Q91WZ8 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000072170 Gene: ENSMUSG00000057531
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000105755 Gene: ENSMUSG00000057531
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | Not available | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | 100% | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All alleles(47) : Targeted, other(2) Gene trapped(43) Spontaneous(1) Chemically induced(1) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | Embryos, Sperm, gDNA | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MMRRC Submission | 010468-UCD | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2016-05-13 3:09 PM by Stephen Lyon | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | unknown | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2008-04-10 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description | Mice with the salt and pepper (spp) phenotype were identified due to their diluted coat color (Figure 1). They were further found to exhibit marked susceptibility to murine cytomegalovirus (MCMV) infection (MCMV Susceptibility and Resistance Screen), and impaired natural killer (NK) cell cyotoxicity in vivo as measured by reduced clearance of MHC class 1-deficient cells (In vivo NK cell and CD8+ T cell cytotoxicity screen). Spp is allelic to sandy (sdy) (1).
Salt and pepper mice also display reduced type I interferon (IFN) responses to CpG DNA challenge in vivo (Figure 2) (2). This screen is designed to identify mutations that specifically affect plasmacytoid dendritic cell (pDC) development and function as pDCs are the primary type I IFN producing cell type in response to Toll-like receptor 9 (TLR9), which senses CpG DNA. |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
The spp mutation corresponds to an A to T transversion in the donor splice site of intron 5 (GTAAGT -> GTTAGT) of the Dtnbp1 gene on Chromosome 13 (position 19359 in the Genbank genomic region NC_000079 for linear genomic DNA sequence of Dtnbp1). The mutation results in skipping of the 133-nucleotide exon 5 (out of 10 total exons), destroying the reading frame in the middle of the encoded protein (aberrant amino acids after position 74), and creating a predicted premature stop codon that would truncate the protein after amino acid 76:
<-- exon 4 <--exon 5 intron 5--> exon 6-->
16053 GCTGGCGAG……GCAAGCCTGGGTAAGTGTG…………CTCATTTAG 31927
72 -A--G--E-……-A--S--L- -L--I--* 76
correct deleted aberrant
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
At least two alternatively spliced transcripts of Dtnbp1 exist, encoding the full length 352 amino acid protein, and a shorter isoform lacking amino acids 171-222 (3). Both forms interact with β-dystrobrevin in yeast two-hybrid experiments (3). On Western blots, two closely spaced bands react specifically with an antibody against the last 156 amino acids of dysbindin; the lower molecular weight band may correspond to the shorter Dtnbp1 transcript (3).
The spp mutation alters the consensus splice donor site of intron 5, likely weakening it and causing skipping of exon 5. The predicted result is a severely truncated dysbindin protein with two aberrant C-terminal amino acids. The drastic shortening of dysbindin may render the protein unstable and lead to degradation, but this has not been confirmed.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression/Localization |
By Northern blot analysis, Dtnbp1 transcript was found in all tissues examined, including brain, thymus, lung, heart, skeletal muscle, stomach, small intestine, liver, kidney, spleen, testis and skin (3). The highest levels were detected in testes, liver, kidney, brain, heart, and lung. When transfected into COS-7 cells, dysbindin is found both diffusely localized in the cytoplasm as well as in the nucleus (3). In muscle cells, dysbindin is found at the sarcolemma (plasma membrane) (3). Dysbindin expression is widespread in the brain, is confined to neurons, and appears to be particularly evident in axons as well as axon terminals (3;5).
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Background |
Dysbindin was first identified as a 40 kD α- and β-dystrobrevin-interacting protein in yeast two-hybrid screens, which aimed to understand the role of dystrobrevins in the dystrophin-associated protein complex (DPC) in muscle and brain (3). The DPC [also called the dystrophin-glycoprotein complex (DGC)] is a membrane-spanning oligomeric complex required for normal muscle function, and impaired or absent assembly of the complex at the sarcolemma reduces the stability of the membrane, compromising muscle function and leading to muscle degeneration (6;7). Thus, mutations in dystrophin cause Duchenne muscular dystrophy (OMIM #310200), an X-linked disorder characterized most distinctively by progressive proximal muscular degeneration and pseudohypertrophy of the calves. α-dystrobrevin-deficient mice also develop mild muscular dystrophy (8). In agreement with the yeast two-hybrid results, dysbindin could be co-immunoprecipitated with α- and β-dystrobrevin, as well as with dystrophin, and therefore appeared to be a component of the DPC (3).
Dysbindin is also a component of the BLOC-1 complex. Mutations in several BLOC-1 subunits cause Hermansky-Pudlak Syndrome-like disease in mice (9). First described in 1959, HPS (OMIM #203300) is a heterogeneous disorder with an array of clinical symptoms caused by alterations at numerous independent loci. HPS is characterized by oculocutaneous albinism (OCA), prolonged bleeding, and pulmonary fibrosis, conditions that arise from defects in the biogenesis and/or function of so-called lysosome-related organelles, such as melanosomes and platelet dense granules (9). These organelles are cell-type specific modifications of the post-Golgi endomembrane system, and may share various characteristics with lysosomes, such as integral membrane proteins and an acidic intralumenal pH (10). At least eight types of human HPS have been described, and mutations affecting at least 15 loci in mice create HPS-like disease. The human HPS loci and their mouse equivalents are as follows: HPS1/pale ear (11); HPS2/pearl (mutated in bullet gray) (12); HPS3/cocoa (mutated in pam gray) (13); HPS4/light ear (14); HPS5/ruby-eye 2 (mutated in toffee and dorian gray) (15); HPS6/ruby-eye (mutated in stamper-coat) (146); HPS7/sandy (17); and HPS8/putatively reduced pigmentation (17).
Mutations in dysbindin have been demonstrated to cause the sandy (sdy) phenotype in mice and are reported to be associated with Hermansky-Pudlak Syndrome 7 (HPS7) in humans (OMIM *607145) (16). Dtnbp1sdy mice are spontaneously occurring mutants exhibiting diluted pigmentation of eyes and fur, and prolonged bleeding times (1). Platelet dense granules are drastically reduced in number and platelets have both an impaired ability to take up a fluorescent dye and have a reduced collagen-induced aggregation rate in sandy mice (1). Melanosomes, some of which are morphologically abnormal, are also greatly reduced in cells of the eye and skin of sandy mice. The sandy phenotype is caused by a 38 kb deletion in the Dtnbp1 gene spanning sequence from intron 5 to intron 7, which results in the complete absence of dysbindin protein expression (16). In humans, six non-pathological polymorphisms in DTNBP1 were identified among 22 unrelated HPS patients who did not have mutations in HPS1, HPS3, HPS4, HPS5 or HPS6 (16). One nonsense mutation, C307T resulting in the change Q103X, was also identified in one patient.
Dysbindin is a confirmed component of the BLOC-1 complex, as shown by coimmunoprecipitation of dysbindin, pallidin and muted from transfected cells, as well as cofractionation of dysbindin and pallidin in size exclusion chromatography and sedimentation velocity analysis of mouse liver extracts (16;20). However, α- and β-dystrobrevin did not cofractionate with dysbindin or pallidin in this experiment (16). Furthermore, a recent re-examination of the interactions between dysbindin and dystrobrevins found that although they interact specifically in yeast two-hybrid experiments, only small amounts of dystrobrevins are coimmunoprecipitated with dysbindin from mouse muscle or brain tissue, comparable to amounts immunoprecipitated using irrelevant control antibodies (4). Further experiments revealed that the dysbindin binding site for dystrobrevins, which mapped to the coiled-coil domain, overlaps with the binding site for the BLOC-1 subunits pallidin, snapin and muted (4). The association between dysbindin and dystrobrevins may therefore be a non-specific coimmunoprecipitation artifact, a possibility supported by the lack of a muscular phenotype in sandy or pallid mice and the HPS patient with the nonsense DTNBP1 mutation (4;16). Alternatively, associations between dysbindin and either the DPC or BLOC-1 complexes may be mutually exclusive and/or cell type specific.
Several SNPs in the human DTNBP1 gene are reportedly associated with schizophrenia, a psychotic disorder with multiple symptoms including hallucinations, inappropriate emotional responses, disordered thinking and erratic behavior (OMIM #181500) (21;22). However, another study found no association between the haplotypes identified in (21) and (22) and schizophrenia in a different patient sample set (23). Still other studies find different haplotypes associated with disease (24). Recently, comparison of all reported putative disease-associated haplotypes with genotype data from the HapMap project suggested that the inconsistent haplotypes reported in the association studies are unlikely due to population differences, since the haplotype patterns and frequencies are similar to and consistent with those of HapMap samples (from individuals with similar descent) (25). Thus, the association of DTNBP1 SNPs with schizophrenia cannot be verified at this time. Neither the HPS patient with the C307T mutation nor sandy mice display behavioral or neurological phenotypes (16), consistent with a lack of association between dysbindin mutations and schizophrenia.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism |
Although the pigmentation and platelet phenotypes of dysbindin mutant mice and humans are well documented, the precise mechanisms by which dysbindin regulates either melanocyte or platelet functions are still unknown. Pallidin has been shown to interact with actin filaments (20) and BLOC-1 interacts with AP-3 to support protein trafficking on endosomes (27). BLOC-1 has recently been demonstrated to function in selective cargo (i.e. tyrosinase-related protein-1, Tyrp1) exit from early endosomes toward melanosomes (28). In addition, the BLOC-1 complex is involved in localization of the copper transporter ATP7A to the melanosome (see records for Tigrou and Tigrou-like). ATP7A is then able to supply copper to tyrosinase, which is critical for tyrosinase enzymatic activity and subsequent pigment production (29). Mutations of AP-3 complex components affect the trafficking of melanosomes in melanocyte dendrites, preventing the appropriate accumulation of melanosomes at the ends of dendrites (see concrete). These data support a role for BLOC-1 and dysbindin in regulating specific protein trafficking in melanosomes.
As mentioned above, pallidin also binds to the t-SNARE syntaxin 13 (19), and snapin interacts with SNAP-25 in neurons (20). The SNARE [SNAP (soluble NSF attachment protein) receptor] complex mediates vesicle targeting and fusion with target membranes [reviewed in (30)]. It is composed of at least three SNARE motif-containing proteins (one v-SNARE from the vesicle and two or three t-SNAREs from the target membrane) which form a four-helix bundle that is thought to bring apposing membranes into close enough proximity for fusion. SNARE complexes all contain one synaptobrevin-related protein (v-SNARE), one syntaxin-related protein (t-SNARE), a protein related to the N-terminal part of SNAP-25 (t-SNARE), and a protein related to the C-terminal part of SNAP-25 (t-SNARE). Each of these proteins contributes one α-helix to the four-helix bundle. In the case of the neuronal synaptic SNARE complex, two of the SNARE motifs are provided by SNAP-25. The interaction of BLOC-1 complex proteins with SNARE proteins suggests that BLOC-1 may specifically affect membrane trafficking by regulating the targeting and fusion of vesicles.
Mutations in some HPS proteins cause immunodeficiency, as observed in spp mice. For example, in HPS2, mutation of the β3A subunit of the AP-3 complex results in immunodeficiency because of defects in NK cells, cytotoxic T lymphocytes (CTLs) and neutrophils (see bullet gray) (31-34). Interestingly, BLOC-1 complex mutant mice pallid, muted and sandy have normal CTL function, as measured by ability to kill targets (35). Immunodeficiency in spp mice may therefore be due to a specific defect in NK cell function, which remains to be further investigated.
The defect in type I IFN response to CpG displayed by salt and pepper mice suggest a specific defect in pDCs, which are the primary type I IFN producing cells in vivo during most viral infections (36). As components of the innate immune system, these cells express endosomally-localized TLR7 and TLR9, which enable the detection of internalized viral and bacterial nucleic acids, such as ssRNA (via TLR7) or CpG DNA (via TLR9). TLR7 and 9 signaling occurs via the adaptor protein myeloid differentiation (MyD) 88 (see pococurante and lackadaisical) resulting in the activation of the NF-κB pathway and production of proinflammatory cytokines such as TNF-α (see panr1), as well as the production of large amounts of type I IFN. Type I IFNs are pleiotropic anti-viral proteins mediating a wide range of effects. Both TNF-α and type I IFN production by pDCs depends on components of the MyD88 signaling pathway including interleukin receptor associated kinase (IRAK)-1 and IRAK-4 (see otiose), interferon response factor (IRF) 5, TNF receptor–associated factor 6 (TRAF6), inhibitor of kappa-B kinase-α (IKKα), osteopontin, and IRF7 (see the record for inept) [reviewed in (37;38)]. The multispanning ER membrane protein UNC93B (mutated in 3d), which is required for trafficking of TLRs 3, 7, and 9 to the endosomal compartment (39), is also necessary for pDCs to sense nucleic acids. pDCs from TLR9-deficient or TLR7-deficient mice (see records for CpG1 and rsq1) fail to produce type I IFN in response to various viral and bacterial pathogens [reviewed by (40)]. An acidic endosomal environment has been shown to be essential for appropriate TLR7 and TLR9 signaling (41-43).
LROs share various characteristics with lysosomes and endolysosomes, such as an acidic intralumenal pH (44), and it is possible that trafficking and biogenesis of the endosomal or similar compartment in pDCs is also dependent on HPS proteins. Indeed, mice with mutations in the β3A subunit of the AP-3 complex, and HPS5 also display a defect in pDC function (2), and analysis of DC generated from pearl homozygous mice with a mutation in Ap3b1 suggests that AP-3 is required for the type I IFN response by trafficking TLR9 to a specialized subcellular compartment (45). Interestingly, the pDC-specific phenotypes identified in mice with mutations in HPS genes parallel those found in mice homozygous for a mutation in Slc15a4 (see the record for feeble), which encodes PHT1, a proton-dependent oligopeptide transporter (2). PHT1 contains a typical acidic di-leucine motif required for AP-3 transport. PHT1 may regulate endosomal TLR7 and TLR9 signaling either by transporting a critical component into or out of the endosome, or by maintaining the appropriate pH necessary for TLR activation. Thus, the HPS proteins, including dysbindin, may be required to transport multiple proteins required for TLR signaling to their appropriate subcellular location.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers | Primers cannot be located by automatic search. | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping |
Salt and pepper genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition. The same primers are used for PCR amplification and for sequencing.
Primers
Salt(F): 5’- TGACCTTGGAGTCTTTGGGTTAGATGTCTGATAC -3’
Salt(R): 5’- CAGACATAGGCAAATAGGTAACACACACAAAGC-3’
PCR program
1) 94°C 2:00
2) 94°C 0:15
3) 60°C 0:20
4) 68°C 1:00
5) repeat steps (2-4) 35X
6) 68°C 5:00
7) 4°C ∞
The following sequence of 584 nucleotides (from Genbank genomic region NC_000079 for linear DNA sequence of Dtnbp1) is amplified:
18985 tgacct tggagtcttt gggttagatg tctgatacaa
19021 gagcagtttg aggtctgctg tacaaatact gagttccttc ctcttctaag aaaaaccagc
19081 aacacaagtg gcactgtctt cagtgtcact gccatctgta gaccatggag ggttgctaaa
19141 gacaaactgg ccgggcctcg gctcgttgac tgactgtgtg cttgagatgt ggttttcctg
19201 agccccgctg gtctgtgttg cagctggtgg acagcgaggt ggtcatgctg tctgcccact
19261 gggagaagaa gaggaccagc ctgaacgagc tgcaggggca gctgcagcag ctgcccgctc
19321 tcctgcagga cttggagtct ctgatggcaa gcctgggtaa gtgtggcctg tgtgtgagag
19381 cagtttcaaa gccctccaag aattcatcaa ttctcagcta ttgctttgaa aataatagtg
19441 cattcttatt gttatataga aatgtattca tttctaaaat ttaccactaa tgctttctgc
19501 ctacagtaag ctaaggaaat aattttagtt ttgttgcttt gtgtgtgtta cctatttgcc
Primer binding sites are underlined; the mutated A is highlighted in red.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References |
10. Cutler, D. F. (2002) Introduction: lysosome-related organelles, Semin. Cell Dev. Biol. 13, 261-262.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Eva Marie Y. Moresco | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Diantha La Vine | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Philippe Georgel, Karine Crozat, Sophie Rutschmann, Amanda L. Blasius, Bruce Beutler |