Phenotypic Mutation 'blossom' (pdf version)
Alleleblossom
Mutation Type missense
Chromosome16
Coordinate19,957,139 bp (GRCm38)
Base Change T ⇒ A (forward strand)
Gene Klhl6
Gene Name kelch-like 6
Chromosomal Location 19,946,496-19,983,037 bp (-)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-like (KLHL) family of proteins, which is involved in B-lymphocyte antigen receptor signaling and germinal-center B-cell maturation. The encoded protein contains an N-terminal broad-complex, tramtrack and bric a brac (BTB) domain that facilitates protein binding and dimerization, a BTB and C-terminal kelch (BACK) domain, and six C-terminal kelch repeat domains. Naturally occurring mutations in this gene are associated with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spleen hypoplasia, defects in mature B-cell subsets with normal pro- and pre-B-cell development, severely impaired antigen-dependent germinal center formation, and reduced memory IgG response. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_183390; MGI:2686922

Mapped Yes 
Limits of the Critical Region 19946499 - 19983037 bp
Amino Acid Change Aspartic acid changed to Valine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000053023] [ENSMUSP00000130755]
SMART Domains Protein: ENSMUSP00000053023
Gene: ENSMUSG00000043008
AA Change: D223V

DomainStartEndE-ValueType
BTB 70 167 1.43e-25 SMART
BACK 172 274 1.68e-35 SMART
Kelch 376 419 3.05e-1 SMART
Kelch 420 466 6.82e-11 SMART
Kelch 467 514 4.27e-3 SMART
Kelch 515 556 3.06e-4 SMART
Kelch 557 604 3.47e-3 SMART
Predicted Effect probably damaging

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
(Using ENSMUST00000058839)
SMART Domains Protein: ENSMUSP00000130755
Gene: ENSMUSG00000043008

DomainStartEndE-ValueType
Pfam:BTB 60 98 1.2e-9 PFAM
Predicted Effect noncoding transcript
Meta Mutation Damage Score 0.068 question?
Is this an essential gene? Probably nonessential (E-score: 0.074) question?
Phenotypic Category
Phenotypequestion? Literature verified References
FACS B:T cells - decreased
FACS CD4+ T cells - increased
FACS CD8+ T cells - increased
FACS T cells - increased
Candidate Explorer Status CE: potential candidate; human score: 0.5; ML prob: 0.22
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(5) : Chemically induced (ENU)(1) Targeted(4)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Klhl6 APN 16 19957062 missense probably benign 0.00
IGL01465:Klhl6 APN 16 19982822 missense probably damaging 0.98
IGL01831:Klhl6 APN 16 19953485 missense probably damaging 1.00
IGL01971:Klhl6 APN 16 19949526 missense probably damaging 0.99
IGL02532:Klhl6 APN 16 19957082 missense possibly damaging 0.84
IGL03113:Klhl6 APN 16 19957251 missense possibly damaging 0.68
IGL03290:Klhl6 APN 16 19947137 missense probably benign 0.44
Ascension UTSW 16 19947098 missense probably damaging 1.00
besmirched UTSW 16 19949447 splice site probably null
cerulean UTSW 16 19957218 nonsense probably null
heights UTSW 16 19957028 missense probably damaging 0.98
Lazuli UTSW 16 19956966 frame shift probably null
Parula UTSW 16 19957043 missense possibly damaging 0.56
torres_del_paine UTSW 16 19948127 missense probably damaging 1.00
IGL03046:Klhl6 UTSW 16 19982889 missense probably benign
R0265:Klhl6 UTSW 16 19948234 missense probably benign 0.43
R0496:Klhl6 UTSW 16 19956966 frame shift probably null
R0497:Klhl6 UTSW 16 19956966 frame shift probably null
R0540:Klhl6 UTSW 16 19957014 missense possibly damaging 0.95
R0541:Klhl6 UTSW 16 19949447 splice site probably null
R0554:Klhl6 UTSW 16 19953593 missense probably damaging 0.96
R0607:Klhl6 UTSW 16 19957014 missense possibly damaging 0.95
R0636:Klhl6 UTSW 16 19948073 splice site probably benign
R0670:Klhl6 UTSW 16 19949559 missense possibly damaging 0.92
R1477:Klhl6 UTSW 16 19965977 missense probably benign 0.00
R1510:Klhl6 UTSW 16 19947098 missense probably damaging 1.00
R1547:Klhl6 UTSW 16 19966082 missense probably benign
R1747:Klhl6 UTSW 16 19947028 missense probably benign 0.40
R1871:Klhl6 UTSW 16 19957043 missense possibly damaging 0.56
R1966:Klhl6 UTSW 16 19982822 missense probably damaging 0.98
R2058:Klhl6 UTSW 16 19982931 missense probably benign
R4466:Klhl6 UTSW 16 19957268 missense probably damaging 0.99
R4645:Klhl6 UTSW 16 19947147 missense probably damaging 1.00
R4690:Klhl6 UTSW 16 19957284 missense probably benign 0.44
R4824:Klhl6 UTSW 16 19957028 missense probably damaging 0.98
R4833:Klhl6 UTSW 16 19957139 missense probably damaging 1.00
R4835:Klhl6 UTSW 16 19957033 missense probably benign 0.07
R5001:Klhl6 UTSW 16 19946991 makesense probably null
R5475:Klhl6 UTSW 16 19948127 missense probably damaging 1.00
R5700:Klhl6 UTSW 16 19957218 nonsense probably null
R5867:Klhl6 UTSW 16 19982820 missense probably benign 0.37
R5910:Klhl6 UTSW 16 19957094 missense probably benign 0.04
R6992:Klhl6 UTSW 16 19953587 missense probably damaging 1.00
R7082:Klhl6 UTSW 16 19982883 missense probably benign 0.00
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2019-05-24 4:36 PM by Diantha La Vine
Record Created 2016-12-07 10:31 PM by Jin Huk Choi
Record Posted 2018-07-20
Phenotypic Description
Figure 1. Blossom mice exhibit a reduced B to T cell ratio. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 2. Blossom mice exhibit increased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Blossom mice exhibit increased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 4. Blossom mice exhibit increased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The blossom phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4833, some of which showed a decrease in the B to T cell ratio (Figure 1) caused by a increased frequencies of total T cells (Figure 2), CD4+ T cells (Figure 3), and CD8+ T cells (Figure 4), all in the peripheral blood. 

Nature of Mutation

Figure 5. Linkage mapping of the increased frequency of T cells using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 71 mutations (X-axis) identified in the G1 male of pedigree R4833. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

hole exome HiSeq sequencing of the G1 grandsire identified 71 mutations. All of the above anomalies were linked by continuous variable mapping to a mutation in Klhl6:  an A to T transversion at base pair 19,957,139 (v38) on chromosome 16, or base pair 25,911 in the GenBank genomic region NC_000082 encoding Klhl6. The strongest association was found with a recessive model of linkage to the normalized frequency of total T cells, wherein four variant homozygotes departed phenotypically from 11 homozygous reference mice and 16 heterozygous mice with a P value of 1.451 x 10-7 (Figure 5).  A substantial semidominant effect was observed in most of the assays. 

 

The mutation corresponds to residue 714 in the mRNA sequence NM_183390 within exon 3 of 7 total exons.

 

698 CACATCTTGAGGAGTGACGACCTGTGTGTGACT
218 -H--I--L--R--S--D--D--L--C--V--T-
 

The mutated nucleotide is indicated in red.  The mutation results in an aspartic acid (D) to valine (V) substitution at position 233 (D223V) in the KLHL6 protein (Figure 6), and is strongly predicted by PolyPhen-2 to be damaging (score = 1.000).

Protein Prediction
Figure 6. Domain structure of the KLHL6 protein. KLHL6 is a member of the Kelch-like family. The blossom mutation (D223V) is indicated. Please see the text for more details about these domains. BTB, Broad-complex, Tramtrack and Bric à brac domain; BACK, BTB and C-terminal kelch domain. The image is interactive. Additional mutations found in KLHL6 are noted. Click each mutation to view more information. Domain information is from SMART and UniProt.

KLHL6 is a member of the Kelch-like family (see the record for teeny for information about KBTBD2, another Kelch-like family member). Similar to other Kelch-like family members, KLHL6 has a Bric-a-brac, Tramtrack, Broad-complex (BTB) domain at the N-terminus, a BACK domain, and a kelch repeat region at the C-terminus (KLHL6 has five or six kelch repeats) (Figure 6(1). BTB domains facilitate protein-protein interactions, the BACK domain has no known function, and Kelch domains form a tertiary structure of β-propellers that have a role in extracellular functions, morphology, and binding to other proteins.

 

The blossom mutation results in an aspartic acid (D) to valine (V) substitution at position 233 (D223V) in the KLHL6 protein; amino acid 223 is within the BACK domain.

 

Please see the record cerulean for more information about Klhl6.

Putative Mechanism

KLHL6 has putative functions in B cell receptor-associated signal transduction and germinal center responses (2). Loss of KLHL6 expression results in impaired transitional B cell survival and differentiation (3). Klhl6-deficient (Klhl6-/-) mice exhibited impaired B cell development past the immature stage, reduced numbers of B220+ and CD3- B cells in the spllen and peripheral blood, reduced numbers of follicular B cells in the lymph nodes, reduced spleen weight, spleen hypoplasia, impaired germinal center formation, and impaired memory IgG responses (2). Mice homozygous for an ENU-induced Klhl6 mutation (W267*) exhibited increased numbers of immature B cells, but reduced numbers of mature B cells (MGI).

 

Putative functions for KLHL6 in T cells has not been described. The role of KLHL6 in B cells is unknown, but it may contribute to cell proliferation and cell survival through interactions with proteins (e.g., HBXIP and Cul3) (3).

Primers PCR Primer
blossom(F):5'- TGGTACATCCTGGCTTCCTG -3'
blossom(R):5'- CTCACAGAAGCATTGAACCCGG -3'

Sequencing Primer
blossom_seq(F):5'- GACTTCAGGGCACTGTCTAATAAG -3'
blossom_seq(R):5'- GCATTGAACCCGGAAAATTGTATTGG -3'
References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsXue Zhong, Bruce Beutler