Phenotypic Mutation 'strawberry' (pdf version)
Allelestrawberry
Mutation Type nonsense
Chromosome15
Coordinate98,909,263 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Lmbr1l
Gene Name limb region 1 like
Synonym(s) 1110013E13Rik, D15Ertd735e
Chromosomal Location 98,903,917-98,918,231 bp (-)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene disruption display normal morphology, clinical chemistry, hematology, and behavior. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_029098; MGI:1289247

Mapped Yes 
Limits of the Critical Region 98903921 - 98918231 bp
Amino Acid Change Cysteine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000023736] [ENSMUSP00000104755]
SMART Domains Protein: ENSMUSP00000023736
Gene: ENSMUSG00000022999
AA Change: C212*

DomainStartEndE-ValueType
Pfam:LMBR1 28 269 2e-41 PFAM
Pfam:LMBR1 266 450 1.2e-35 PFAM
Predicted Effect probably null
SMART Domains Protein: ENSMUSP00000104755
Gene: ENSMUSG00000022999

DomainStartEndE-ValueType
Pfam:LMBR1 1 324 6.3e-110 PFAM
Predicted Effect noncoding transcript
Meta Mutation Damage Score 0.6256 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category
Phenotypequestion? Literature verified References
CD8 response - decreased
CTL killing - decreased
CTL killing dominant epitope - decreased
FACS B cells - increased
FACS B:T cells - increased
FACS B1 cells - increased
FACS B1a cells in B1 cells - decreased
FACS B220 MFI - decreased
FACS CD11b+ DCs (gated in CD11c+ cells) - decreased
FACS CD4+ T cells - decreased
FACS CD4+ T cells in CD3+ T cells - decreased
FACS CD44+ CD4 MFI - increased
FACS CD44+ CD8 MFI - increased
FACS CD44+ T cells - decreased
FACS CD44+ T MFI - increased
FACS CD8+ T cells - decreased
FACS central memory CD4 T cells in CD4 T cells - increased
FACS central memory CD8 T cells in CD8 T cells - increased
FACS effector memory CD4 T cells in CD4 T cells - increased
FACS effector memory CD8 T cells in CD8 T cells - increased
FACS IgD MFI - decreased
FACS IgD+ B cell percentage - increased
FACS IgM MFI - increased
FACS IgM+ B cells - increased
FACS macrophages - increased
FACS naive CD4 T cells in CD4 T cells - decreased
FACS naive CD8 T cells in CD8 T cells - decreased
FACS neutrophils - increased
FACS NK cells - decreased
FACS NK T cells - decreased
FACS T cells - decreased
Fasting Insulin - decreased
MCMV susceptibility
NK cell response - decreased
NK killing - decreased
T-dependent humoral response defect- decreased antibody response to OVA+ alum immunization
T-dependent humoral response defect- decreased antibody response to rSFV
T-independent B cell response defect- decreased TNP-specific IgM to TNP-Ficoll immunization
total IgE after 2nd OVA/Alum - decreased
Total IgE After 2nd OVA/Alum Challenge (day 7) - decreased
Candidate Explorer Status CE: excellent candidate; human score: 0.5; ML prob: 1
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(9) : Chemically induced (other)(1) Gene trapped(1) Radiation induced(2) Targeted(5)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Lmbr1l APN 15 98904785 missense probably damaging 1.00
IGL02097:Lmbr1l APN 15 98917891 missense probably damaging 0.98
IGL02731:Lmbr1l APN 15 98917896 missense probably damaging 0.96
morula UTSW 15 98904791 missense probably damaging 1.00
R0310:Lmbr1l UTSW 15 98908773 splice site probably benign
R1778:Lmbr1l UTSW 15 98912476 missense probably damaging 1.00
R2418:Lmbr1l UTSW 15 98907537 missense possibly damaging 0.89
R2419:Lmbr1l UTSW 15 98907537 missense possibly damaging 0.89
R4181:Lmbr1l UTSW 15 98908720 missense possibly damaging 0.94
R4379:Lmbr1l UTSW 15 98909263 nonsense probably null
R4472:Lmbr1l UTSW 15 98906297 missense probably benign 0.02
R5290:Lmbr1l UTSW 15 98912242 missense probably damaging 1.00
R5410:Lmbr1l UTSW 15 98909262 missense probably damaging 1.00
R5436:Lmbr1l UTSW 15 98904791 missense probably damaging 1.00
R5667:Lmbr1l UTSW 15 98907608 missense possibly damaging 0.88
R5671:Lmbr1l UTSW 15 98907608 missense possibly damaging 0.88
R5918:Lmbr1l UTSW 15 98912427 missense probably damaging 0.99
R6735:Lmbr1l UTSW 15 98909240 missense probably damaging 1.00
R6882:Lmbr1l UTSW 15 98907586 missense probably damaging 0.99
R7131:Lmbr1l UTSW 15 98906323 missense probably benign 0.05
Mode of Inheritance Autosomal Recessive
Local Stock
Repository
Last Updated 2019-05-14 3:15 PM by Anne Murray
Record Created 2016-05-04 11:29 PM by Jin Huk Choi
Record Posted 2019-05-14
Phenotypic Description

Figure 1. Strawberry mice exhibit decreased frequencies of peripheral CD11b+ DCs. Flow cytometric analysis of peripheral blood was utilized to determine DC frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 2. Strawberry mice exhibit decreased frequencies of peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 3. Strawberry mice exhibit decreased frequencies of peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 4. Strawberry mice exhibit decreased frequencies of peripheral CD4+ T cells in CD3+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 5. Strawberry mice exhibit decreased frequencies of peripheral naive CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 6. Strawberry mice exhibit decreased frequencies of peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 7. Strawberry mice exhibit decreased frequencies of peripheral naive CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 8. Strawberry mice exhibit decreased frequencies of peripheral NK cells. Flow cytometric analysis of peripheral blood was utilized to determine NK cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 9. Strawberry mice exhibit decreased frequencies of peripheral NK T cells. Flow cytometric analysis of peripheral blood was utilized to determine NK T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 10. Strawberry mice exhibit increased frequencies of peripheral B1 cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 11. Strawberry mice exhibit increased frequencies of peripheral central memory CD8 T cells in CD8 T cells. Flow cytometric analysis of peripheral blood was utilized to determine T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 12. Strawberry mice exhibit increased frequencies of peripheral effector memory CD4 T cells in CD4 T cells. Flow cytometric analysis of peripheral blood was utilized to determine B1 cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 13. Strawberry mice exhibit increased frequencies of peripheral macrophages. Flow cytometric analysis of peripheral blood was utilized to determine macrophage frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 14. Strawberry mice exhibit increased frequencies of peripheral neutrophils. Flow cytometric analysis of peripheral blood was utilized to determine neutrophil frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 15. Strawberry mice exhibit increased B to T cell ratios. Flow cytometric analysis of peripheral blood was utilized to determine B and T cell frequency. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 16. Strawberry mice exhibit increased CD44 expression on peripheral T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 17. Strawberry mice exhibit increased CD44 expression on peripheral CD4+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 18. Strawberry mice exhibit increased CD44 expression on peripheral CD8+ T cells. Flow cytometric analysis of peripheral blood was utilized to determine CD44 MFI. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 19. Homozygous strawberry mice exhibit diminished T-dependent IgG responses to ovalbumin administered with aluminum hydroxide. IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

Figure 20. Homozygous strawberry mice exhibit diminished T-dependent IgG responses to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal). IgG levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 21. Homozygous strawberry mice exhibit diminished T-independent IgM responses to NP-Ficoll. IgM levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 22. Strawberry mice exhibited decreased IgE secretion in response to OVA/alum. IgE levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 23. Strawberry mice exhibited reduced CTL-mediated killing of target cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.
Figure 24. Strawberry mice exhibited reduced NK-mediated killing of target cells. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The strawberry phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R4379, some of which showed reduced frequencies of CD11b+ dendritic cells (DCs) (Figure 1), T cells (Figure 2) CD4+ T cells (Figure 3), CD4+ T cells in CD3+ T cells (Figure 4), naïve CD4 T cells in CD4 T cells (Figure 5), CD8+ T cells (Figure 6), naïve CD8 T cells in CD8 T cells (Figure 7), natural killer (NK) cells (Figure 8), and NK T cells (Figure 9) with concomitant increased frequencies of B1 cells (Figure 10), central memory CD8 T cells in CD8 T cells (Figure 11), effector memory CD4 T cells in CD4 T cells (Figure 12), macrophages (Figure 13), and neutrophils (Figure 14), all in the peripheral blood (1). The B to T cell ratio was increased (Figure 15). CD44 expression was increased on T cells (Figure 16), including both CD4 (Figure 17) and CD8 (Figure 18) T cells. The T-dependent antibody responses to ovalbumin administered with aluminum hydroxide (Figure 19) and to recombinant Semliki Forest virus (rSFV)-encoded β-galactosidase (rSFV-β-gal) were diminished (Figure 20) (1).  The T-independent antibody response to 4-hydroxy-3-nitrophenylacetyl-Ficoll (NP-Ficoll) was also diminished (Figure 21). The level of IgE was reduced after administration of OVA/alum (Figure 22). Some mice also showed decreased cytotoxic T lymphocyte (Figure 23) and NK (Figure 24) cell target killing. T cells in the Lmbr1l-deficient mice show exaggerated apoptosis.

Nature of Mutation

Figure 25. Linkage mapping of the B to T cell ratio phenotype using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 57 mutations (X-axis) identified in the G1 male of pedigree R4379. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 57 mutations. All of the above anomalies were linked by continuous variable mapping to two mutations on chromosome 15: Lmbr1l and Cers5. The mutation in Lmbr1l was presumed causative, and is a C to A transversion at base pair 98,909,263 (v38) on chromosome 15, or base pair 8,986 in the GenBank genomic region NC_000081 encoding Lmbr1l. The strongest association was found with a recessive model of inheritance to the B to T cell ratio, wherein six variant homozygotes departed phenotypically from 15 homozygous reference mice and 25 heterozygous mice with a P value of 7.155 x 10-17 (Figure 25).  

 

The mutation corresponds to residue 813 in the mRNA sequence NM_029098 within exon 8 of 17 total exons.

 

796 CTGCTGCTTCTGGTGTGCACTCCACTAGGTCTC

207 -L--L--L--L--V--C--T--P--L--G--L-

 

The mutated nucleotide is indicated in red. The mutation results in substitution of cysteine 212 to a premature stop codon (C212*) in the LMBR1L protein.

 

The causative mutation for several of the phenotypes was validated to be in Lmbr1l by CRISPR-mediated knockout of Lmbr1l (Table 1).

 

Screen name

P value

FACS CD8+ T cells

6.557 x 10-27

FACS T cells

6.342 x 10-25

In vivo NK cell cytotoxicity

4.247 x 10-24

FACS naïve CD8 T cells in CD8 T cells

8.363 x 10-24

T-dependent antibody response to rSFV-β-gal)

3.375 x 10-20

FACS CD8+ T cells

3.351 x 10-19

FACS naïve CD4 T cells in CD4 T cells

6.093 x 10-17

T-independent B cell response

1.398 x 10-16

FACS CD44+ CD8 MFI

1.517 x 10-16

FACS CD44+ T MFI

3.135 x 10-15

In vivo CTL cytotoxicity

7.155 x 10-15

FACS effector memory CD4 T cells in CD4 T cells

1.045 x 10-13

FACS CD44+ CD4 MFI

7.75 x 10-13

FACS central memory CD8 T cells in CD8 T cells

1.112 x 10-11

FACS B1 cells

2.349 x 10-11

FACS macrophages

3.23 x 10-11

FACS NK cells

5.007 x 10-9

FACS CD4+ T cells in CD3+ T cells

1.595 x 10-6

FACS NK T cells

3.801 x 10-6

FACS neutrophils

2.257 x 10-5

Protein Prediction
Figure 26. Domain organization and topography of LMBR1L. The strawberry mutation results in substitution of cysteine 212 to a premature stop codon. Other mutations found in the protein are noted in red. Click on each allele for more information.

LMBR1L (alternatively, lipocalin-interacting membrane receptor; LIMR) is one of four lipocalin receptors. The lipocalin receptors do not share sequence homology with each other or with other receptor families; however, the receptors may share similarities in their topography in the lipid bilayer (2).

 

LMBR1L has an extracellular N-terminus, nine putative transmembrane domains, a large intracellular loop between the fifth and sixth transmembrane domains, and an intracellular C-terminus (Figure 26) (3).  The LMBR1L extracellular N-terminus contains a putative lipocalin (LCN1) binding site and binding sites for other putative ligands (see the Background section for more information about LMBR1L ligands) [(3-5); reviewed in (2)]. LMBR1L is predicted to form dimers and higher order oligomers (2).

 

The strawberry mutation results in substitution of cysteine 212 to a premature stop codon (C212*); residue 212 is within the fifth transmembrane domain.

Expression/Localization

LMBR1L is highly expressed in testis, pituitary gland, adrenal gland, trachea, placenta, thymus, cerebellum, stomach, mammary gland, spinal cord, fetal kidney, and fetal lung, and weaker expression in colon, pancreas and prostate (3). LMBR1L is localized to the plasma membrane and on the endoplasmic reticulum membrane.

Background
Figure 27. LMBR1L function in lymphopoiesis.  LMBR1L is a transmembrane protein expressed on the plasma and ER membranes. It functions as a negative feedback regulator of Wnt signaling. In the ER of lymphocytes, a second Wnt/β-catenin pathway destruction complex exists, consisting of LMBR1L, GP78, and UBAC2. This complex ubiquitinates and prevents maturation of FZD6 and Wnt co-receptor LRP6 within the ER of lymphocytes and may also regulate the ubiquitination and degradation of β-catenin.  Absent this second destruction complex, FZD6 and LRP6 accumulate on the plasma membrane and enhanced Wnt signaling overwhelms the canonical destruction complex, causing β-catenin to flood the nucleus. Additionally, LMBR1L physically interacts with and stabilizes GSK-3β. 

Lipocalins are secreted proteins (e.g., a-1-microglobulin, a-1-acid glycoprotein, and C8-g) that transport hydrophobic molecules (e.g., steroids, bilins, retinoids, and lipids) to function in several processes, including animal behavior, immunity, iron metabolism, signal transduction, development, and vision [reviewed in (2)]. The lipocalins bind to the lipocalin receptors LMBR1L, megalin, 24p3R, and STRA6. The function of LMBR1L will be discussed in further detail, below. Megalin is an endocytic receptor (6). 24p3R regulates intracellular iron levels and apoptosis upon binding and internalization of its ligand, 24p3 (7). STRA6 is a receptor for retinol binding protein, and mediates uptake of retinol from holo-retinol binding protein (8).

 

LMBR1L is a receptor for several ligands, including LCN1, bovine lipocalin β-lactoglobulin [BLG] (4), the LCN1 porcine homolog von Ebner's gland protein [pVEG], and the secretoglobin uteroglobin [UG]) (5)) [(3); reviewed in (2)]. Further studies using single cycle kinetics experiments showed that while LMBR1L is a specific receptor for LCN1, it does not show high affinity for pVEG, UG, or BLG (2). These findings indicate that either LMBR1L is not a receptor for pVEG, UG, or BLG, or that these putative ligands bind the receptor at sites distinct from that of LCN1 that are unexposed, inaccessible, or inactive. LCN1 is mainly expressed at epithelial surfaces, and presumably has a scavenging function in which it removes potentially harmful xenobiotics (9). LCN1 comprises 20 to 30 percent of the protein fraction in human tears whereby it reduces surface tension and regulates tear viscosity by binding lipids and interacting with other proteins (10-12). UG putatively suppresses cell motility and invasion upon binding to LMBR1L (5). BLG is the major milk whey protein of most mammals except for primates (13); the biological function of BLG is unknown.  Two of the ligands (e.g., LCN1 and BLG) were internalized in the NT2 human teratocarcinoma cell line in a LMBR1L-dependent manner, leading to their degradation (3;4;14). LCN1 internalization was not unique to NT2 cells as LCN1 internalization was also observed in the human breast cancer T-47D cell line (14).

 

LMBR1L is a putative negative regulator of the Wnt/β-catenin and ERAD signaling pathways independent of its function in lipocalin binding (Figure 27(1). LMBR1L regulates the expression of mature forms of Wnt co-receptors and phosphorylated GSK-3β as well as the expression of multiple destruction complex proteins. Within the ER, LMBR1L is a component of a destruction complex along with GP78 and UBAC2, which functions to regulate Wnt receptor availability and subsequent Wnt signaling activity (1). LMBR1L also regulates the expression and/or stabilization of the β-catenin destruction complex through its participation in the GP78-UBAC2 complex (1). Co-immunoprecipitation (co-IP) combined with mass spectrometry identified 25 proteins that were more than 50-fold more abundant in the LMBR1L co-IP relative to the control (1). Four of these putative LMBR1L interacting proteins were components of the ERAD pathway (e.g., UBAC2, TERA, UBXD8, and GP78). Several components of the Wnt/β-catenin signaling pathway were also identified in the LMBR1L co-IP, including zinc and ring finger 3 (ZNRF3), low-density lipoprotein receptor-related protein 6 (LRP6), β-catenin, glycogen synthase kinase-3α (GSK3α), and GSK3β (1). Microarray analysis identified additional putative LMBR1L-interacting proteins, including β-catenin and casein kinase 1 (CK1) isoforms CK1α, γ, δ, and ε (1). Co-transfection of HA-tagged LMBR1L with FLAG-tagged Wnt pathway components verified interactions with GSK-3β, β-catenin, ZNRF3, FZD6, LRP6, DVL2, UBAC2, UBXD8, VCP, and GP78.

 

Mice homozygous for a Lmbr1l gene disruption display normal morphology, clinical chemistry, hematology, and behavior (MGI:3604480).

Putative Mechanism

LMBR1L functions in T and B cell differentiation (Figure 27(1). Strawberry T cells showed increased T cell apoptosis due to aberrant Wnt/β-catenin signaling activation (1). Loss of LMBR1L expression resulted in upregulation of the expression of mature forms of the Wnt co-receptors and phosphorylated GSK3β with concomitant reduced expression of several destruction complex proteins. As a result, β-catenin accumulated, entered the nucleus, and promoted the transcription of target genes (e.g., Myc, Trp53, and Cd44).

Primers PCR Primer
strawberry(F):5'- TGTGTTCTGACCAACTCCAG -3'
strawberry(R):5'- GCAAGACAAGTTGACATGGC -3'

Sequencing Primer
strawberry_seq(F):5'- GTGTTCTGACCAACTCCAGATGATG -3'
strawberry_seq(R):5'- AGACTTCTGGGAGTACTACCTC -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation (A>G @ 99751253 bp in the Cers5 gene).

 

PCR Primers

R43790047_PCR_F: 5’- CCATGTGCCGCACCTATTAGTG-3’

R43790047_PCR_R: 5’- AAATAACGGGTTTCTGGTTCCTAG-3’

 

Sequencing Primers

R43790047_SEQ_F: 5’- AGTGCTACTCTCCATTAGTCCATTAG-3’
 

R43790047_SEQ_R: 5’- AACGGGTTTCTGGTTCCTAGTCTTG-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 402 nucleotides is amplified (NCBI RefSeq: NC_000081, chromosome 15:99751066-99751467):

  

ccatgtgccg cacctattag tgctactctc cattagtcca ttagccaagc attcaaacac       

atgagtctat gggggccata cctattcaaa cctccacact tacctttctt acatatgctg      

tctccccacc tatggagcac ccttctgtgg ccttcatccg gctcacttac cttagtaaca      

gatacgaaca ccttctcaag ggtgtcattg ggttccacct tattgacagg actgtcttta      

atgccaacac ggagtgcaca gggcttggca ataaatctgt aacaaagaaa atccaaggac      

aattctaaat atagtttgct aaatatgacg acggggtcct gattggaata ttaatggagg      

gaaaatggaa acccaagact aggaaccaga aacccgttat tt

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = A>G; sense strand = T>C).



Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation (G>T @ 98,909,263 (assembly) in the Lmbr1l gene [see here for the Incidental page]).

 

PCR Primers

R43790046_PCR_F: 5’- TGTGTTCTGACCAACTCCAG-3’

R43790046_PCR_R: 5’- GCAAGACAAGTTGACATGGC-3’

 

Sequencing Primers

R43790046_SEQ_F: 5’- GTGTTCTGACCAACTCCAGATGATG-3’
 

R43790046_SEQ_R: 5’- AGACTTCTGGGAGTACTACCTC-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 460 nucleotides is amplified (NCBI RefSeq: NC_000081, chromosome 15):

  

tgtgttctga ccaactccag atgatgggaa ggggtgctgg ggtgggggtg gggggcaaca       

acacagaagc caagcaaggg tgtggccttc aaatgtagga aattggccct gagcaagagg      

cagggagcac tacatactac atactacata ctacatacta catactacat acccggggct      

tgaccagcaa cttcccagtg acagagaaca tgcgggcgag acctagtgga gtgcacactg      

taggcacaag agctggtcag tcacatgcca gacctttcac tccctcccca cacctcctcc      

ttccaccctg actgatgccc acgatgccct cttcctctcc cagattctga cactcaccca      

gaagcagcag aactccgagg aaggagatac aggagtagag ataggggagg tagtactccc      

agaagtctag gacaataaaa gccatgtcaa cttgtcttgc

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = G>T; sense strand = C>A)

References
Science Writers Anne Murray
Illustrators Diantha La Vine
AuthorsMalcolm MacConmara, Evan Nair-Gill, Jin Huk Choi, James Butler, Takuma Misawa, Bruce Beutler