Allele | potbelly2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mutation Type | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | 6 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coordinate | 29,069,089 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Base Change | C ⇒ A (forward strand) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene | Lep | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | leptin | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 29,060,220-29,073,875 bp (+) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
MGI Phenotype |
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is secreted by white adipocytes, and which plays a major role in the regulation of body weight. This protein, which acts through the leptin receptor, functions as part of a signaling pathway that can inhibit food intake and/or regulate energy expenditure to maintain constancy of the adipose mass. This protein also has several endocrine functions, and is involved in the regulation of immune and inflammatory responses, hematopoiesis, angiogenesis and wound healing. Mutations in this gene and/or its regulatory regions cause severe obesity, and morbid obesity with hypogonadism. This gene has also been linked to type 2 diabetes mellitus development. [provided by RefSeq, Jul 2008] PHENOTYPE: Homozygotes are obese, hyperphagic, have low activity, high metabolic efficiency, impaired thermogenesis, infertility and short lifespan in addition to varying other abnormalities. Strain background affects severity and course of diabetes. Heterozygotes survive fasting longer than control mice. [provided by MGI curators] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Number | NCBI Refseq: NM_008493.3; MGI:104663 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mapped | Yes | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Histidine changed to Asparagine | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for protein(s): [ENSMUSP00000067046] [ENSMUSP00000130087] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | P41160 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000067046 Gene: ENSMUSG00000059201 AA Change: H47N
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | probably benign
PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000130087 Gene: ENSMUSG00000059201 AA Change: H47N
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect | possibly damaging
PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Meta Mutation Damage Score | 0.7275 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Is this an essential gene? | Non Essential (E-score: 0.000) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Category | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Candidate Explorer Status | loading ... | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Single pedigree Linkage Analysis Data |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Penetrance | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Alleles Listed at MGI | All Mutations and Alleles(13) : Chemically induced (ENU)(2) Spontaneous (2) Targeted(6) Transgenic (3) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Lab Alleles |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Mode of Inheritance | Autosomal Recessive | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Local Stock | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Repository | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Last Updated | 2019-09-04 9:43 PM by Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Created | 2016-02-09 5:15 PM | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Record Posted | 2016-05-06 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotypic Description |
The potbelly2 phenotype was identified among G3 mice of the pedigree R1585, some of which exhibited elevated body weights compared to wild-type controls (Figure 1). |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Nature of Mutation |
Whole exome HiSeq sequencing of the G1 grandsire identified 82 mutations. The body weight phenotype was linked to a mutation in Lep: a C to A transversion at base pair 29,069,090 (v38) on chromosome 6, or base pair 10,628 in the GenBank genomic region NC_000072 encoding Lep. Linkage was found with a recessive model of inheritance (P = 5.69 x 10-4), wherein one affected mouse was homozygous for the variant allele, and 38 unaffected mice were either heterozygous (n = 21) or homozygous (n = 17) for the reference allele (Figure 2). The mutation corresponds to residue 198 in the mRNA sequence NM_008493 in exon 2 of 3 total exons.
The mutated nucleotide is indicated in red. The mutation results in a histidine (H) to asparagine (N) substitution at position 47 (H47N) in the leptin protein, and is strongly predicted by PolyPhen-2 to be benign (score = 0.272). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustration of Mutations in Gene & Protein |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Protein Prediction |
The Lep (alternatively, ob) gene encodes leptin, a highly conserved adipocyte-secreted hormone and member of the class I helical cytokine family [Figure 3; (1-3)]. Leptin regulates several physiological processes including appetite, energy homeostasis, body weight, neuroendocrine systems [i.e., the growth hormone axis, thyroid axis, hypothalamic-pituitary-gonadal axis, and adrenal axis (4-7)], immune functions (i.e., thymic homeostasis, secretion of IL-1 and TNF-α, and promotion of Th1-cell differentiation [reviewed in (8)]), and glycaemia [reviewed in (9)]. The 167 amino acid leptin has a 21 amino acid N-terminal signal sequence that is cleaved during leptin maturation (10). Vertebrate leptins have two conserved cysteine residues (Cys117 and Cys167 in mouse leptin) that form an intramolecular disulfide bond between the C-terminus and the beginning of the CD loop (11;12). Three conserved leptin receptor (LepR; see the records for Business class, Cherub, and Well-upholstered) binding sites on leptin have been identified: site I is on the face of helix D and is proposed to bind the cytokine receptor homology 1 (CRH1) or CRH2 domain of the LepR, site II is composed of residues on the surface of helices A and C and binds the CRH2 domain of LepR, and site III is at the N-terminus of helix D at the interface of the N-terminus of helix D and the AB loop and binds the immunoglobulin-like domain of LepR (1;13). Binding site II is proposed to be the main high affinity binding site for receptor-ligand interaction (14;15), while site III is proposed to function in forming the active multimeric complex and activating the receptor (16). Mutagenesis of mouse and human leptins in the proximity of binding site III have identified Tyr-140, Ser-141, and Thr-142 as essential for activation, but not binding, of leptin to LepR (16). In addition to the three binding sites in leptin, the highly conserved GLDFIP sequence at aa 38-43 in human leptin is required for LepR activation (1;17;18). The leptin tertiary structure resembles that of other class I cytokines in that it has a four-helix bundle (helices A-D) with an up-up-down-down topology (19;20). A nuclear magnetic resonance (NMR) study determined that in mouse leptin, Helix A is amino acids 3-24, Helix B is aa 51-67, Helix C is aa 72-94, and Helix D is aa 122-141 (19). Parallel to the helical bundle is a hydrophobic cylindrical core formed from conserved residues of the four alpha helices (11). Leptin differs structurally from other class I cytokines in that it has a small helical segment (i.e., helix E) within the loop between helices C and D [aa 95-121 (11)]. The potbelly2 mutation results in substitution of histidine 47 for an asparagine. Residue 47 is between helices A and B. For more information about Lep, please see the record for Potbelly. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative Mechanism | Leptin, a systemic hormone, regulates multiple functions of the body including energy utilization and storage, various endocrine axes, bone metabolism, thermoregulation, angiogenesis, immunity and inflammation [reviewed in (21)]. In humans, mutations in LEP are linked to morbid obesity, with or without hypogonadism [OMIM: +164160; (22-24)]. The Lepob (ob) mouse strain (MGI:1856424) is morbidly obese and is characterized by hyperinsulinemia, hyperglucocorticoidemia, hypothalamic hypothyroidism, defects in cell-mediated and humoral immunity, impaired thermogenesis, hyperglycemia, insulin resistance, altered central nervous system activity, reduced metabolic rate of brown adipose tissue, infertility, and lethargy (25;26). The obesity phenotype of the potbelly2 mice mimics that of other Lep mouse models (27-29). Expression and secretion of leptin in the potbelly2 mice has not been examined, but the phenotype suggests that expression and/or secretion of leptin is reduced in the potbelly2 mice. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primers |
PCR Primer potbelly2_pcr_F: ATCCTATAGCAGGATGGCAGCAGG potbelly2_pcr_R: TTTCAGCAGGCAGCAGTGACAAG Sequencing Primer potbelly2_seq_F: CATATTGGGCTCTTGAAAAGTGTC potbelly2_seq_R: AGTGACAAGAGCCATGACC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Genotyping | PCR program 1) 94°C 2:00 The following sequence of 400 nucleotides is amplified (chromosome 6, + strand): 1 atcctatagc aggatggcag caggaccatt ggatggattc atattgggct cttgaaaagt Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
References | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Science Writers | Anne Murray | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Illustrators | Peter Jurek | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Authors | Emre Turer and Bruce Beutler |