Phenotypic Mutation 'inwood2' (pdf version)
Alleleinwood2
Mutation Type nonsense
Chromosome13
Coordinate100,223,014 bp (GRCm38)
Base Change G ⇒ T (forward strand)
Gene Naip5
Gene Name NLR family, apoptosis inhibitory protein 5
Synonym(s) Birc1e, Lgn1, Naip-rs3
Chromosomal Location 100,211,739-100,246,323 bp (-)
MGI Phenotype PHENOTYPE: This locus controls resistance to Legionella pneumophila, the organism responsible for Legionnaire's disease. Cultured peritoneal macrophages from A/J mice are susceptible, supporting bacterial proliferation; other strains, e.g., C57BL/6 are resistant. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_010870; MGI:1298220

Mapped Yes 
Amino Acid Change Tyrosine changed to Stop codon
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000058611]
SMART Domains Protein: ENSMUSP00000058611
Gene: ENSMUSG00000071203
AA Change: Y571*

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
BIR 58 129 1.08e-19 SMART
BIR 157 229 1.06e-36 SMART
BIR 276 347 2.14e-32 SMART
Pfam:NACHT 464 618 1.7e-36 PFAM
low complexity region 851 862 N/A INTRINSIC
Predicted Effect probably null
Meta Mutation Damage Score 0.6296 question?
Is this an essential gene? Probably nonessential (E-score: 0.075) question?
Phenotypic Category
Phenotypequestion? Literature verified References
Nlrc4 inflammasome: low response
Candidate Explorer Status CE: excellent candidate; human score: 2; ML prob: 0.84
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All Mutations and Alleles(3) : Spontaneous(1) Targeted(1) Transgenic(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Naip5 APN 13 100246175 nonsense probably null
IGL00493:Naip5 APN 13 100230771 missense probably damaging 0.96
IGL01294:Naip5 APN 13 100217080 missense probably damaging 0.99
IGL01405:Naip5 APN 13 100221945 missense probably benign 0.11
IGL01568:Naip5 APN 13 100217101 missense probably benign 0.26
IGL01804:Naip5 APN 13 100221584 missense probably damaging 1.00
IGL02012:Naip5 APN 13 100223339 missense probably benign 0.01
IGL02183:Naip5 APN 13 100221642 missense probably benign 0.41
IGL02449:Naip5 APN 13 100222175 missense probably benign 0.34
IGL02815:Naip5 APN 13 100222731 missense probably benign
IGL02992:Naip5 APN 13 100223028 missense probably damaging 1.00
IGL03027:Naip5 APN 13 100223016 missense probably benign 0.00
IGL03234:Naip5 APN 13 100212627 missense probably damaging 1.00
inwood3 UTSW 13 100221903 nonsense probably null
PIT4131001:Naip5 UTSW 13 100219739 missense probably benign
PIT4131001:Naip5 UTSW 13 100219760 missense probably benign 0.00
R0001:Naip5 UTSW 13 100214650 critical splice donor site probably null
R0001:Naip5 UTSW 13 100223114 missense probably benign
R0462:Naip5 UTSW 13 100221732 missense probably damaging 1.00
R0636:Naip5 UTSW 13 100219688 missense probably benign
R0674:Naip5 UTSW 13 100223199 missense probably benign 0.04
R0764:Naip5 UTSW 13 100217105 missense probably benign 0.03
R0837:Naip5 UTSW 13 100230743 missense probably benign
R1179:Naip5 UTSW 13 100219830 missense probably benign
R1302:Naip5 UTSW 13 100221591 missense possibly damaging 0.91
R1441:Naip5 UTSW 13 100219717 missense possibly damaging 0.95
R1513:Naip5 UTSW 13 100222206 missense probably benign
R1638:Naip5 UTSW 13 100212669 missense probably damaging 1.00
R1651:Naip5 UTSW 13 100221911 missense probably benign 0.41
R1707:Naip5 UTSW 13 100242855 missense probably damaging 1.00
R1835:Naip5 UTSW 13 100223218 nonsense probably null
R1836:Naip5 UTSW 13 100219687 missense probably benign 0.18
R1972:Naip5 UTSW 13 100212770 missense probably damaging 0.98
R2080:Naip5 UTSW 13 100221533 missense probably damaging 1.00
R2333:Naip5 UTSW 13 100223171 missense probably damaging 1.00
R2348:Naip5 UTSW 13 100219738 missense probably benign 0.01
R3055:Naip5 UTSW 13 100221878 missense probably benign 0.23
R3401:Naip5 UTSW 13 100221903 nonsense probably null
R3723:Naip5 UTSW 13 100223014 nonsense probably null
R3775:Naip5 UTSW 13 100223375 missense probably benign 0.00
R3775:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4019:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223375 missense probably benign 0.00
R4020:Naip5 UTSW 13 100223394 missense probably benign 0.00
R4074:Naip5 UTSW 13 100246064 missense probably damaging 1.00
R4082:Naip5 UTSW 13 100245830 missense probably damaging 1.00
R4105:Naip5 UTSW 13 100219739 missense probably benign
R4227:Naip5 UTSW 13 100212768 missense probably damaging 0.99
R4639:Naip5 UTSW 13 100219830 missense probably benign
R4640:Naip5 UTSW 13 100219830 missense probably benign
R4641:Naip5 UTSW 13 100219830 missense probably benign
R4644:Naip5 UTSW 13 100219830 missense probably benign
R4645:Naip5 UTSW 13 100219830 missense probably benign
R4700:Naip5 UTSW 13 100223414 missense possibly damaging 0.62
R4727:Naip5 UTSW 13 100221870 missense possibly damaging 0.81
R4729:Naip5 UTSW 13 100222131 missense possibly damaging 0.75
R4816:Naip5 UTSW 13 100219681 missense probably benign 0.32
R4816:Naip5 UTSW 13 100219687 missense probably benign 0.01
R4816:Naip5 UTSW 13 100219696 missense probably benign 0.00
R4869:Naip5 UTSW 13 100245131 missense probably damaging 1.00
R5162:Naip5 UTSW 13 100223406 missense possibly damaging 0.78
R5244:Naip5 UTSW 13 100245662 missense probably benign 0.08
R5411:Naip5 UTSW 13 100245746 missense possibly damaging 0.54
R5632:Naip5 UTSW 13 100230662 splice site probably null
R5760:Naip5 UTSW 13 100242838 missense probably damaging 1.00
R5916:Naip5 UTSW 13 100222701 missense probably benign 0.02
R6302:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6304:Naip5 UTSW 13 100223166 missense possibly damaging 0.76
R6411:Naip5 UTSW 13 100223405 missense probably benign 0.01
R6474:Naip5 UTSW 13 100214663 missense possibly damaging 0.82
R6499:Naip5 UTSW 13 100221594 missense probably benign
R6544:Naip5 UTSW 13 100223144 missense possibly damaging 0.50
R6827:Naip5 UTSW 13 100245929 missense possibly damaging 0.48
R6954:Naip5 UTSW 13 100223414 missense probably damaging 0.99
R7052:Naip5 UTSW 13 100222347 missense probably benign 0.01
R7138:Naip5 UTSW 13 100219830 missense probably benign
R7141:Naip5 UTSW 13 100219830 missense probably benign
R7375:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7375:Naip5 UTSW 13 100219697 missense not run
R7401:Naip5 UTSW 13 100219696 missense probably benign 0.00
R7401:Naip5 UTSW 13 100219697 missense not run
Mode of Inheritance Autosomal Recessive
Local Stock Sperm
Repository
Last Updated 2019-09-04 9:44 PM by Anne Murray
Record Created 2015-11-29 11:01 PM by Hexin Shi
Record Posted 2015-12-23
Phenotypic Description

Figure 1. Inwood2 mice exhibited decreased IL-1β secretion in response to priming with flagellin. IL-1β levels were determined by ELISA. Normalized data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The inwood2 phenotype was identified among N-ethyl-N-nitrosourea (ENU)-mutagenized G3 mice of the pedigree R3723, some of which exhibited impaired peritoneal macrophage NLRC4 inflammasome responses, marked by decreased secretion of the proinflammatory cytokine interleukin (IL)-1β in response to priming with flagellin (Figure 1).

Nature of Mutation

Figure 2. Linkage mapping of the reduced NLRC4 inflammasome function using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 41 mutations (X-axis) identified in the G1 male of pedigree R3723. Normalized phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity. Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 41 mutations. The diminished NLRC4 inflammasome function phenotype was linked by continuous variable mapping to a mutation in Naip5: a C to A transversion at base pair 100,223,014 (v38) on chromosome 13, or base pair 31,758 in the GenBank genomic region NC_000079 for the Naip5 gene. Linkage was found with a recessive model of inheritance (P = 4.547 x 10-5), wherein four variant homozygotes departed phenotypically from 17 homozygous reference mice and 27 heterozygous mice (Figure 2).  

 

The mutation corresponds to residue 1,926 in the mRNA sequence NM_010870 within exon 9 of 14 total exons.

 

1909 CTGATTACAAAAAACTACTTGTCACGGACCTGC

566  -L--I--T--K--N--Y--L--S--R--T--C-

 

The mutated nucleotide is indicated in red.  The mutation results in substitution of tyrosine (Y) 571 for a premature stop codon (Y571*) in the NAIP5 protein.

Protein Prediction
Figure 3. Protein domain structure of NAIP5. Shown are the baculovirus inhibitor of apoptosis repeats (BIRs), the NACHT [NAIP (neuronal apoptosis inhibitor protein), C2TA (MHC class 2 transcription activator), HET-E (incompatibility locus protein from Podospora anserina) and TP1 (telomerase-associated protein)] domain, and the leucine-rich repeat (LRR) region. The amino acid altered by the inwood2 mutation is shown. The image is interactive; click to view other Naip5 mutations.

Neuronal apoptosis inhibitor protein 5 [NAIP5; alternatively, baculoviral inhibitor of apoptosis protein (IAP) repeat-containing 1e (Birc1e)] is a member of the NACHT-LRR (NLR) family of cytosolic proteins that recognize pathogen-associated molecular patterns (PAMPs) on pathogens. NACHT-LRR is an acronym for NAIP (neuronal apoptosis inhibitor protein), C2TA (MHC class 2 transcription activator), HET-E (incompatibility locus protein from Podospora anserina), and TP1 (telomerase-associated protein)-leucine-rich repeat.

 

The NLR proteins have similar domains, including a conserved NACHT domain [alternatively, nucleotide-binding domain (NBD)] that mediates protein dimerization, a conserved leucine-rich repeat (LRR) region that recognizes ligands, and a signaling module (alternatively, effector domain) that assists in binding downstream signaling molecules. The signaling modules are unique to each subclass of NLR family members. For example, the NLRC proteins have caspase recruitment domains (CARDs), the NLRP proteins have a pyrin domain (PYD), and the NAIP proteins have baculovirus inhibitor of apoptosis repeats (BIRs). NAIP5 has three BIRs (amino acids 60-127, 159-227, and 278-345), a NACHT domain (amino acids 464-648, SMART), and several leucine-rich repeats (LRRs) [Figure 3; reviewed in (1)]. The BIR1 and BIR2 domains, but not the BIR3 domain, are required for NAIP5-associated responses to Legionella pneumophila (L. pneumophila) infection (2). NAIP5 and NLRC4 interact via the NACHT domain. The LRR region is proposed to function in the recognition of microbes, whereby promoting NAIP5 oligomerization. Deletion of the LRR domain results in diminished response to bacterial infection and low constitutive activity (2).

 

Four NAIP proteins, NAIP1, NAIP2, NAIP5, and NAIP6, are expressed in the mouse from a multigene cluster on chromosome 13qD1 (3); there is a single known human NAIP ortholog. Mouse NAIP1 and human NAIP recognize type III secretion system (T3SS) needle proteins, NAIP2 binds with the T3SS rod component PrgJ, and NAIP5 and NAIP6 interact with flagellin (4).

 

The inwood2 mutation results in the substitution of tyrosine (Y) 571 for a premature stop codon. Tyr571 is within the NACHT domain.

Expression/Localization

Naip5 mRNA is highly expressed in the intestinal tract, spleen, lung, liver, and isolated primary macrophages (5). NAIP5 protein is expressed in the ileum, colon, spleen, and macrophages (5).

Background
Figure 4. Activation of the NLRC4 inflammasome. Infection of macrophages with various gram-negative bacteria activates caspase-1 via NLRC4. A critical step is the cytosolic delivery of flagellin or proteins through the bacterial T3SS or T4SS. Flagellin is recognized by Naip5 or Naip6, whereas rod proteins are recognized by Naip2. S. flexneri activates the NLRC4 inflammasome independently of flagellin through IpaB. Activation of caspase-1 via NLRC4 leads to the processing and release of IL-1β and IL-18, the processing of caspase-7, and pyroptosis. The image is interactive; click to view other mutations associated with the NLRC4 inflammasome. This image is interactive; click to view other mutations associated with the NLRC4 inflammasome pathway.

Members of the NLR family, including NLRC4 (see the record for inwood), NLRP1b, and NLRP3 (see the record for Nd1), are able to oligomerize through their NACHT domains and assemble into large caspase-1-activating multiprotein complexes, termed inflammasomes, upon the detection of pathogenic or other danger signals in the cytoplasm. Inflammasome assembly is activated in response to diverse signals, including pathogens, DNA, single-stranded (ss) RNA, double-stranded (ds) RNA, bacterial toxins, and environmental irritants as well as endogenous danger signals [reviewed by (6;7)]. 

 

The NLRC4 inflammasome stimulates caspase-1 activation and subsequent IL-1β secretion from macrophages after exposure to lipopolysaccharide, peptidoglycan, and pathogenic bacteria (Figure 4) (8). Activated caspase-1 is able to cleave a variety of substrates, most notably the proinflammatory cytokines IL-1β, IL-18 and IL-33 to generate biologically active proteins. In turn, these cytokines mediate a wide variety of biological effects associated with infection, inflammation, and autoimmune processes by activating the nuclear factor κB (NF-κB; see the record for panr2) and mitogen-activated protein kinase (MAPK; see the record for wabasha) signaling pathways. For more information about the NLRC4 inflammasome, please see the record for inwood.

 

The NAIP5/NLRC4 inflammasome is primarily activated by Gram-negative bacteria including L. pneumophila (2;3;9), Aeromonas veronii (10), Pseudomonas aeruginosa (11), Salmonella enterica serovar typhimurium (S. typhimurium) (11-14), Yersinia pestis (15), and Shigella flexneri (16). NLRC4-mediated responses to S. typhimurium are only partially dependent on NAIP5 (9). NAIP5 is essential for NLRC4 inflammasome activation by L. pneumophila, a Gram-negative bacteria found in aquatic environments and leads to a severe form of pneumonia called Legionnaires’ disease (2;9;17-19). L. pneumophila is ingested by phagocytic cells, and survives in a vacuole that segregates from the endocytic network (20).  The L. pneumophila-containing phagosomes do not mature into phagolysosomes, but the L. pneumophila localizes within a membrane-bound vacuole. L. pneumophila infection requires flagellin (21;22). Inside of host macrophages, L. pneumophila induces the expression of genes that encode factors in the Dot/Icm T4SS (23;24). NAIP5 interacts with the 35 C-terminal amino acids as well as the conserved N-helix of flagellin (25). After cytosolic flagellin recognition, NAIP5 associates with NLRC4, forming an oligomeric complex, and subsequently leading to the activation of caspase-1 in a TLR5-independent manner (26;27). The NLRC4 inflammasome promotes both caspase-1-dependent and –independent responses to restrict the growth of L. pneumonphila (22;28). In addition, caspase-7 is activated downstream of the NLRC4 inflammasome (24).

 

NAIP5, NLRC4, and caspase-1 are required for the activation of inducible nitric oxide synthase (iNOS) and secretion of nitric oxide (NO) in response to cytosolic flagellin in a TLR5-, IL-1β-, and IL-18-independent manner (29). NAIP5/NLRC4/caspase-1-dependent NO secretion controls L. pneumophila (29) and S. typhimurium growth. The NAIP5/NLRC4 inflammasome is also proposed to mediate the activation of the cytoplasmic enzyme phospholipase A2 (cPLA2) with a subsequent production of lipid inflammatory mediators including prostaglandins and leukotrienes (30). Stimulation with flagellin initiates inflammation and loss of vascular fluids, leading to rapid death in mice in an IL-1β/IL-18- or necroptosis-independent manner.

 

Naip5 alleles determine macrophage permissiveness to L. pneumophila replication (3;31). For example, L. pneumophila proliferates in macrophages derived from A/J mice, but in cultures derived from other strains (e.g., C57BL/6J), proliferation of L. pneumophila is not noted. The A/J Naip5 allele only exhibits a slight defect in pyroptosis and caspase-1 activation in response to L. pneumophila infection (9). There are 14 amino acid substitutions between C57BL/6 and A/J NAIP5 proteins (3). A/J macrophages are able to restrict the intracellular replication of other intracellular pathogens, including Salmonella, Mycobacterium bovis, and Leishmania donovani, indicating that the permissiveness is specific to the replication of L. pneumophila. The alteration in L. pneumophila permissiveness is due to change in NAIP5 function (3;18).  A/J and C57BL/6 mice produce equivalent amounts of IL-6, IL-12, and Cxc11, but A/J mice fail to produce IL-18 (32).

Putative Mechanism

Naip5-deficient (Naip5-/-) macrophages cannot activate caspase-1, release IL-1β, or promote pyroptosis in response to L. pneumophila infection (9). The reduced amount of IL-1β observed in the inwood2 mice in response to flagellin indicates a loss-of-function in NAIP5inwood2.

Primers PCR Primer
inwood2(F):5'- ACTGCTGCTACAAAGAGAGG -3'
inwood2(R):5'- TGGCCAACATCATCTGTGCC -3'

Sequencing Primer
inwood2_seq(F):5'- AGAGGGGTCTTGTAAACTCCC -3'
inwood2_seq(R):5'- ATCTGTGCCCAACTCCTAGGG -3'
Genotyping

PCR program

1) 94°C 2:00
2) 94°C 0:30
3) 55°C 0:30
4) 72°C 1:00
5) repeat steps (2-4) 40x
6) 72°C 10:00
7) 4°C hold


The following sequence of 400 nucleotides is amplified (chromosome 13, - strand):


1   tggccaacat catctgtgcc caactcctag gggcaggagg ttgcattagt gaagtgtgtc
61  tgagcagcag catccagcag ttacaacacc aggtgctgtt cctgttggat gactacagtg
121 ggctggcctc actcccccaa gccctacaca cactgattac aaaaaactac ttgtcacgga
181 cctgcttatt gatcgctgtg catacaaaca gggtcagaga catccgccta tacctaggta
241 caagtctaga gatccaagag tttcccttct ataatactgt ctctgtatta cggaagtttt
301 tttcacatga cataatctgt gtggaaaagc ttataattta ctttattgat aataaagatt
361 tacagggagt ttacaagacc cctctctttg tagcagcagt 


Primer binding sites are underlined and the sequencing primers are highlighted; the mutated nucleotide is shown in red.

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsHexin Shi and Bruce Beutler