Phenotypic Mutation 'juicy' (pdf version)
Allelejuicy
Mutation Type missense
Chromosome18
Coordinate4,339,552 bp (GRCm39)
Base Change A ⇒ C (forward strand)
Gene Map3k8
Gene Name mitogen-activated protein kinase kinase kinase 8
Synonym(s) Tpl2, Cot, Cot/Tpl2, Tpl-2, c-COT
Chromosomal Location 4,331,325-4,352,978 bp (-) (GRCm39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an oncogene that encodes a member of the serine/threonine protein kinase family. The encoded protein localizes to the cytoplasm and can activate both the MAP kinase and JNK kinase pathways. This protein was shown to activate IkappaB kinases, and thus induce the nuclear production of NF-kappaB. This protein was also found to promote the production of TNF-alpha and IL-2 during T lymphocyte activation. This gene may also utilize a downstream in-frame translation start codon, and thus produce an isoform containing a shorter N-terminus. The shorter isoform has been shown to display weaker transforming activity. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice resist endotoxic shock. Their MHC II expression is enhanced. Macrophages' TNF-alpha response to viruses and to all TLR ligands is impaired. Macrophage and T-cell secretion of other cytokines in response to various TLR ligands or OVA is aberrant. Anti-OVA Ig classes are abnormally skewed. [provided by MGI curators]
Accession Number

NCBI RefSeq: NM_007746; MGI: 1346878

MappedYes 
Amino Acid Change Leucine changed to Arginine
Institutional SourceBeutler Lab
Gene Model predicted gene model for protein(s): [ENSMUSP00000025078] [ENSMUSP00000133469]
AlphaFold Q07174
SMART Domains Protein: ENSMUSP00000025078
Gene: ENSMUSG00000024235
AA Change: L273R

DomainStartEndE-ValueType
Pfam:Pkinase 137 388 1.1e-47 PFAM
Pfam:Pkinase_Tyr 139 386 4.6e-26 PFAM
Predicted Effect probably damaging

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
(Using ENSMUST00000025078)
SMART Domains Protein: ENSMUSP00000133469
Gene: ENSMUSG00000024235

DomainStartEndE-ValueType
SCOP:d1phk__ 146 169 2e-4 SMART
Predicted Effect probably benign
Meta Mutation Damage Score 0.9604 question?
Is this an essential gene? Non Essential (E-score: 0.000) question?
Phenotypic Category Autosomal Recessive
Candidate Explorer Status loading ...
Single pedigree
Linkage Analysis Data
Penetrance  
Alleles Listed at MGI

All alleles(10) : Targeted(9) Chemically induced(1)

Lab Alleles
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Map3k8 APN 18 4334660 missense probably damaging 1.00
IGL02483:Map3k8 APN 18 4349318 utr 5 prime probably benign
IGL03174:Map3k8 APN 18 4349247 missense probably damaging 1.00
Flojo UTSW 18 4339548 missense possibly damaging 0.95
gnostic_gospel UTSW 18 4333965 missense probably damaging 1.00
Sluggish UTSW 18 4339608 splice site probably benign
R0304:Map3k8 UTSW 18 4339552 missense probably damaging 0.99
R0569:Map3k8 UTSW 18 4349162 missense probably benign 0.00
R1748:Map3k8 UTSW 18 4334766 missense probably damaging 1.00
R1793:Map3k8 UTSW 18 4332389 nonsense probably null
R2310:Map3k8 UTSW 18 4349001 missense probably benign
R3625:Map3k8 UTSW 18 4333965 missense probably damaging 1.00
R4786:Map3k8 UTSW 18 4340647 nonsense probably null
R4921:Map3k8 UTSW 18 4349124 missense possibly damaging 0.92
R4930:Map3k8 UTSW 18 4349215 nonsense probably null
R4934:Map3k8 UTSW 18 4339548 missense possibly damaging 0.95
R4956:Map3k8 UTSW 18 4339530 missense probably benign 0.00
R5241:Map3k8 UTSW 18 4340750 missense probably damaging 0.98
R5549:Map3k8 UTSW 18 4340762 missense probably damaging 0.98
R6317:Map3k8 UTSW 18 4348979 critical splice donor site probably null
R6326:Map3k8 UTSW 18 4340651 missense probably damaging 1.00
R6910:Map3k8 UTSW 18 4340801 missense probably benign 0.03
R7010:Map3k8 UTSW 18 4334060 missense probably damaging 1.00
R7247:Map3k8 UTSW 18 4334036 missense probably damaging 1.00
R7300:Map3k8 UTSW 18 4349076 missense probably damaging 0.98
R7348:Map3k8 UTSW 18 4340561 missense probably damaging 1.00
R7903:Map3k8 UTSW 18 4349162 missense probably benign 0.00
R8302:Map3k8 UTSW 18 4334064 missense probably damaging 0.97
R8676:Map3k8 UTSW 18 4343137 missense probably benign 0.01
R8847:Map3k8 UTSW 18 4333889 missense
R9068:Map3k8 UTSW 18 4340557 missense probably benign 0.36
R9352:Map3k8 UTSW 18 4349170 missense probably benign
R9460:Map3k8 UTSW 18 4349277 missense probably benign 0.00
R9526:Map3k8 UTSW 18 4333869 missense probably damaging 1.00
R9548:Map3k8 UTSW 18 4349141 missense probably benign
R9632:Map3k8 UTSW 18 4339546 missense probably damaging 0.98
Mode of Inheritance Autosomal Recessive
Local Stock
MMRRC Submission 038246-MU
Last Updated 2017-09-11 5:23 PM by Diantha La Vine
Record Created 2013-08-25 9:52 AM by Ying Wang
Record Posted 2014-09-12
Phenotypic Description
Figure 1. Juicy mice exhibit decreased TNFα secretion after stimulation with the TLR4 agonist, LPS. Values determined by ELISA. Raw data are shown. Abbreviations: WT, wild-type; REF, homozygous reference mice; HET, heterozygous variant mice; VAR, homozygous variant mice. Mean (μ) and standard deviation (σ) are indicated.

The juicy phenotype was identified among G3 mice of the pedigree R0304, some of which showed diminished LPS-induced TNFα secretion (i.e., defective TLR4 signaling) (Figure 1).

Nature of Mutation
Figure 2. Linkage mapping of reduced TNFα secretion after LPS stimulation using a recessive model of inheritance. Manhattan plot shows -log10 P values (Y-axis) plotted against the chromosome positions of 94 mutations (X-axis) identified in the G1 male of pedigree R0304.  Raw phenotype data are shown for single locus linkage analysis without consideration of G2 dam identity.  Horizontal pink and red lines represent thresholds of P = 0.05, and the threshold for P = 0.05 after applying Bonferroni correction, respectively.

Whole exome HiSeq sequencing of the G1 grandsire identified 94 mutations. The defective TLR4 signaling phenotype was linked by continuous variable mapping to a mutation in Map3k8: a T to G transversion at base pair 4,339,552 (v38) on chromosome 18, or base pair 13,930 in the GenBank genomic region NC_000084. Linkage was found with a recessive model of linkage (P = 4.919 x 10-5), wherein 5 variant homozygotes departed phenotypically from 7 homozygous reference mice and 6 heterozygous mice (Figure 2). The mutation corresponds to residue 942 in the NM_007746 mRNA sequence in exon 5 of 8 total exons.

926 TTGGTAGATTTTGGCCTGAGTGTTAAGATGACT

268 -L--V--D--F--G--L--S--V--K--M--T-

The mutated nucleotide is indicated in red.  The mutation results in a leucine (L) to arginine (R) substitution at amino acid residue 273 in the TPL2 protein, and is strongly predicted by Polyphen-2 to cause loss of function (probably damaging; score = 0.989).

Illustration of Mutations in
Gene & Protein
Protein Prediction

Figure 3. Domain structure of TPL2 protein. The TPL2 protein contains an N-terminal domain, a kinase domain, and a C-terminal region. A PEST sequence was identified between residues 415 and 438. There is a conserved ATP-binding lysine (K167), and phosphorylation of T290 is required for activation. The juicy mutation (red asterisk) is a leucine (L) to arginine (R) substitution at amino acid residue 273. The image is interactive; click to see another Map3k8 mutation.

Map3k8 encodes TPL2 (tumor progression locus 2)/COT (cancer Osaka thryoid)/MAP3K8, a serine/threonine kinase member of the mitogen-activated protein kinase kinase kinase (MAP3K) family of proteins (Figure 3). The Juicy mutation (L273R) is within the kinase domain of TPL2 (amino acids 133-388).

Please see the record Sluggish for information about Map3k8.

Putative Mechanism

TPL2 activates the MEK/ERK pathway downstream of most TLRs. Upon TLR stimulation, both p105 and TPL2 are phosphorylated by the IKK complex, resulting in degradation of p105 and the release and activation of TPL2 (1).  Phosphorylation of TPL2 by the IKK complex occurs at T290, and is necessary for both the dissociation of TPL2 from p105, as well as kinase activity (2-4). Activated TPL2 phosphorylates MEK1/2 (MAP kinase 1 and 2), which then activates ERK1/2 (5-7). The juicy phenotype is similar to that of Map3k8Sluggish/Sluggish (8) and TPL2-deficient mice in that TNFα production by juicy macrophages is abnormal in response to TLR agonists. In TPL2-deficient macrophages, the levels of TNF-α are normal, but the transport of TNF-α mRNA to the cytoplasm in response to LPS is defective, suggesting that TPL2 regulates TNF-α mRNA transport, but not stability (6).

Primers PCR Primer
juicy_pcr_F: TGTTCTGGTGACAACGATCATCCAATG
juicy_pcr_R: GAAGCCAAAACCGTGAGCTTTCC

Sequencing Primer
juicy_seq_F: AATGTTGCCATTTTGTCCCC
juicy_seq_R: ACACTAGGTGGGTTCCTGAC
Genotyping

Juicy genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transversion.
 

PCR Primers

Juicy(F): 5’- TGTTCTGGTGACAACGATCATCCAATG-3’

Juicy(R): 5’- GAAGCCAAAACCGTGAGCTTTCC-3’

Sequencing Primer

Juicy_seq(F): 5’- AATGTTGCCATTTTGTCCCC-3’
 

Juicy_seq(R): 5’- ACACTAGGTGGGTTCCTGAC-3’

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

The following sequence of 664 nucleotides is amplified (Chr.18: 4339397-4339843, GRCm38; NC_000084):

tgttctggtg acaacgatca tccaatgttg ccattttgtc cccttcattg ctgattgtca       

cagcatttcc agaccatcac caatacaatc aatcaattac ctctgttccc cggaggtcct      

tgggaagata gacatcttca gtcatcttaa cactcaggcc aaaatctacc aaaacagctt      

ttgtagacat gaatacaatg ttgctagctg caacgagagg ggtttttaat gtgagttaat      

gcatcctaac ccaacaggaa aatcatctag aacagcaagt tccaagcaga gcagaaggaa      

acgcttctga taatgactca ggtggttcac cccagaagag agaagtaggg gagcagtcag      

gtgaaaacac ctgaggcctg tcaggaaccc acctagtgtg ggcagctagg agctacagcc      

agcaggaaag ctcacggttt tggcttc

FASTA sequence

Chr. + strand shown. Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. + strand, T>G; sense strand, A>C).

References
Science Writers Anne Murray
Illustrators Peter Jurek
AuthorsYing Wang, Hexin Shi and Bruce Beutler