Phenotypic Mutations

4 mutations affecting 4 genes are currently displayed.

Mutations Mapped and Identified Based on Phenotype
[records 1 to 4 of 4] per page Full List

Phenotypic Category question?


1 UTSW Klhl6 0.074 16 19946496-19983037 bp (-) 19956966 Autosomal Dominant (3;13)
 Autosomal Semidominant (3;12)
failed initial filter 2019-05-24
Anne Murray
 FACS B cells - decreased
 FACS B:T cells - decreased
 FACS CD4+ T cells - increased
 FACS IgD+ B cell percentage - decreased
 FACS IgM+ B cells - decreased
 FACS T cells - increased
GT ⇒ G frame shift probably null
2 UTSW Il2rb 0.120 15 78479256-78495271 bp (-) 78481834 Autosomal Dominant (2;11)
 Autosomal Semidominant (6;52)
excellent candidate 2019-03-21
Anne Murray
 FACS CD4:CD8 - increased
 FACS CD4+ T cells in CD3+ T cells - increased
 FACS CD44+ CD8 MFI - decreased
 FACS CD8+ T cells - decreased
 FACS CD8+ T cells in CD3+ T cells - decreased
 FACS central memory CD8 T cells in CD8 T cells - decreased
 FACS NK cells - decreased
 FACS NK T cells - decreased
TAGTCA ⇒ TAGTCAGTCA frame shift probably null
3 UTSW Il12a 0.000 3 68690644-68698547 bp (+) 68697987 Autosomal Recessive (1;5) not good candidate 2018-12-20
Anne Murray
 MCMV proliferation in macrophages - increased
 MCMV susceptibility
TCAC ⇒ TC frame shift probably null
4 UTSW Irs1 0.411 1 82233101-82291416 bp (-) 82287732 Unknown (1;0)
 Autosomal Recessive (5;19)
good candidate 2018-10-24
Anne Murray
 Body Weight - decreased
 Body Weight (Male) - decreased
 Fasting Insulin - increased
 Fasting Insulin (Male) - increased
TGGGGTGGACATCGAACTGAAGGAG ⇒ TG frame shift probably null
[records 1 to 4 of 4]