Mutagenetix > Incidental Mutation

Incidental Mutation 'R1023:Ap3d1'

94644

Institutional Source

Beutler Lab

Gene Symbol

Ap3d1

Ensembl Gene

ENSMUSG00000020198

Gene Name

adaptor-related protein complex 3, delta 1 subunit

Synonyms

mBLVR1, Bolvr

MMRRC Submission

039125-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.931) question?

Stock #

R1023 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80542790-80578098 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 80550092 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 713 (L713Q)

Ref Sequence

ENSEMBL: ENSMUSP00000020420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020420] [ENSMUST00000020420] [ENSMUST00000218610]

AlphaFold

O54774

Predicted Effect

probably damaging
Transcript: ENSMUST00000020420
AA Change: L713Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: L713Q

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000020420
AA Change: L713Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: L713Q

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218125

Predicted Effect

probably benign
Transcript: ENSMUST00000218610

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219253

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220183

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.0%
3x: 98.0%
10x: 95.6%
20x: 90.7%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	T	3: 137,772,632 (GRCm39)	A607V	probably damaging	Het
4930523C07Rik	A	G	1: 159,905,057 (GRCm39)		probably benign	Het
Baz2a	A	G	10: 127,957,676 (GRCm39)	T1010A	possibly damaging	Het
Cdh15	T	C	8: 123,591,939 (GRCm39)	I608T	probably damaging	Het
Cdkl2	A	T	5: 92,187,145 (GRCm39)	D40E	possibly damaging	Het
Col9a2	G	A	4: 120,901,207 (GRCm39)	G118R	unknown	Het
Cryge	C	A	1: 65,089,945 (GRCm39)	C79F	probably damaging	Het
Dapk1	T	C	13: 60,878,799 (GRCm39)	L596P	probably damaging	Het
Dqx1	G	A	6: 83,038,070 (GRCm39)	C486Y	probably damaging	Het
Dync2i1	T	C	12: 116,196,277 (GRCm39)	E490G	probably damaging	Het
Enam	A	G	5: 88,649,826 (GRCm39)	Q445R	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 118,989,784 (GRCm39)		probably benign	Het
Gnpat	A	T	8: 125,597,519 (GRCm39)	D27V	probably benign	Het
Htr5a	A	T	5: 28,047,996 (GRCm39)	T184S	possibly damaging	Het
Lap3	C	T	5: 45,652,553 (GRCm39)	P50S	probably benign	Het
Mamdc2	A	T	19: 23,288,271 (GRCm39)	M589K	probably damaging	Het
Mast4	A	G	13: 102,872,004 (GRCm39)	S2263P	probably benign	Het
Mef2b	C	T	8: 70,618,247 (GRCm39)	P109L	possibly damaging	Het
Meltf	T	A	16: 31,703,778 (GRCm39)	F168L	probably damaging	Het
Mib2	C	T	4: 155,743,917 (GRCm39)	G42S	probably damaging	Het
Nup205	T	A	6: 35,211,641 (GRCm39)	F1661I	probably damaging	Het
Or11h4b	A	T	14: 50,918,473 (GRCm39)	L206H	probably damaging	Het
Or5h19	A	T	16: 58,856,178 (GRCm39)	N307K	probably benign	Het
Plac8	A	T	5: 100,704,447 (GRCm39)	D83E	probably benign	Het
Pnpt1	T	C	11: 29,091,328 (GRCm39)		probably benign	Het
Pold2	G	T	11: 5,825,140 (GRCm39)	Q86K	probably benign	Het
Ptprt	A	G	2: 161,400,863 (GRCm39)	L1057P	probably damaging	Het
Rev3l	A	G	10: 39,708,635 (GRCm39)	H2284R	probably damaging	Het
Scart1	T	A	7: 139,804,376 (GRCm39)	C484S	possibly damaging	Het
Skint6	A	C	4: 113,095,300 (GRCm39)	S120A	probably benign	Het
Slc1a7	G	A	4: 107,864,770 (GRCm39)	V270M	probably damaging	Het
Spata2	A	G	2: 167,327,142 (GRCm39)	M85T	probably benign	Het
Taf1b	G	T	12: 24,559,558 (GRCm39)		probably benign	Het
Tert	A	G	13: 73,790,178 (GRCm39)	N844S	probably benign	Het
Thrap3	G	A	4: 126,073,882 (GRCm39)	S288L	possibly damaging	Het
Ubap2l	A	G	3: 89,955,180 (GRCm39)		probably benign	Het
Ubtf	T	C	11: 102,202,276 (GRCm39)	E197G	possibly damaging	Het
Usp20	G	T	2: 30,897,825 (GRCm39)	G216W	probably damaging	Het
Yy1	T	A	12: 108,759,457 (GRCm39)	V40E	unknown	Het
Zfp335	G	A	2: 164,734,505 (GRCm39)	H1254Y	possibly damaging	Het

Other mutations in Ap3d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ap3d1	APN	10	80,577,813 (GRCm39)	missense	probably benign	0.00
IGL00827:Ap3d1	APN	10	80,549,393 (GRCm39)	missense	possibly damaging	0.92
IGL01668:Ap3d1	APN	10	80,554,993 (GRCm39)	missense	possibly damaging	0.95
IGL01934:Ap3d1	APN	10	80,545,092 (GRCm39)	nonsense	probably null
IGL03404:Ap3d1	APN	10	80,565,871 (GRCm39)	missense	probably damaging	1.00
christian	UTSW	10	80,565,876 (GRCm39)	missense	probably damaging	1.00
Particle	UTSW	10	80,546,328 (GRCm39)	splice site	probably null
vesicle	UTSW	10	80,559,661 (GRCm39)	missense	probably damaging	1.00
R0119:Ap3d1	UTSW	10	80,559,449 (GRCm39)	splice site	probably benign
R0197:Ap3d1	UTSW	10	80,565,876 (GRCm39)	missense	probably damaging	1.00
R0356:Ap3d1	UTSW	10	80,563,812 (GRCm39)	missense	probably damaging	1.00
R0372:Ap3d1	UTSW	10	80,559,401 (GRCm39)	missense	probably damaging	1.00
R0491:Ap3d1	UTSW	10	80,555,075 (GRCm39)	missense	probably damaging	1.00
R0636:Ap3d1	UTSW	10	80,555,216 (GRCm39)	nonsense	probably null
R0792:Ap3d1	UTSW	10	80,544,313 (GRCm39)	missense	probably benign
R0942:Ap3d1	UTSW	10	80,568,789 (GRCm39)	splice site	probably benign
R1015:Ap3d1	UTSW	10	80,552,323 (GRCm39)	missense	probably damaging	1.00
R1170:Ap3d1	UTSW	10	80,568,674 (GRCm39)	splice site	probably benign
R1540:Ap3d1	UTSW	10	80,551,775 (GRCm39)	missense	probably benign	0.00
R1639:Ap3d1	UTSW	10	80,565,844 (GRCm39)	missense	probably damaging	0.98
R1664:Ap3d1	UTSW	10	80,553,571 (GRCm39)	nonsense	probably null
R1669:Ap3d1	UTSW	10	80,546,670 (GRCm39)	unclassified	probably benign
R1839:Ap3d1	UTSW	10	80,562,942 (GRCm39)	missense	probably damaging	1.00
R1940:Ap3d1	UTSW	10	80,545,607 (GRCm39)	missense	probably benign	0.03
R2081:Ap3d1	UTSW	10	80,568,770 (GRCm39)	missense	probably damaging	1.00
R2258:Ap3d1	UTSW	10	80,556,966 (GRCm39)	missense	probably benign	0.03
R2281:Ap3d1	UTSW	10	80,549,832 (GRCm39)	missense	probably damaging	0.96
R2398:Ap3d1	UTSW	10	80,555,006 (GRCm39)	nonsense	probably null
R2849:Ap3d1	UTSW	10	80,577,742 (GRCm39)	missense	possibly damaging	0.65
R3856:Ap3d1	UTSW	10	80,548,019 (GRCm39)	missense	probably benign
R4350:Ap3d1	UTSW	10	80,555,119 (GRCm39)	missense	probably benign	0.15
R4590:Ap3d1	UTSW	10	80,555,646 (GRCm39)	nonsense	probably null
R4782:Ap3d1	UTSW	10	80,557,420 (GRCm39)	splice site	probably null
R4785:Ap3d1	UTSW	10	80,548,612 (GRCm39)	frame shift	probably null
R4834:Ap3d1	UTSW	10	80,555,560 (GRCm39)	missense	probably damaging	1.00
R4864:Ap3d1	UTSW	10	80,548,612 (GRCm39)	frame shift	probably null
R5051:Ap3d1	UTSW	10	80,555,033 (GRCm39)	missense	probably damaging	1.00
R5109:Ap3d1	UTSW	10	80,545,284 (GRCm39)	missense	probably benign	0.11
R5219:Ap3d1	UTSW	10	80,545,651 (GRCm39)	missense	probably benign	0.03
R5220:Ap3d1	UTSW	10	80,563,001 (GRCm39)	missense	probably damaging	1.00
R5307:Ap3d1	UTSW	10	80,559,383 (GRCm39)	missense	probably benign	0.29
R5586:Ap3d1	UTSW	10	80,554,964 (GRCm39)	missense	possibly damaging	0.92
R5796:Ap3d1	UTSW	10	80,549,871 (GRCm39)	missense	possibly damaging	0.70
R5905:Ap3d1	UTSW	10	80,558,761 (GRCm39)	missense	possibly damaging	0.50
R6025:Ap3d1	UTSW	10	80,546,298 (GRCm39)	missense	probably benign	0.01
R6028:Ap3d1	UTSW	10	80,558,761 (GRCm39)	missense	possibly damaging	0.50
R6364:Ap3d1	UTSW	10	80,546,328 (GRCm39)	splice site	probably null
R6469:Ap3d1	UTSW	10	80,547,992 (GRCm39)	missense	probably benign
R6603:Ap3d1	UTSW	10	80,549,881 (GRCm39)	missense	probably benign	0.04
R6872:Ap3d1	UTSW	10	80,550,156 (GRCm39)	nonsense	probably null
R6887:Ap3d1	UTSW	10	80,559,532 (GRCm39)	missense	probably damaging	1.00
R7249:Ap3d1	UTSW	10	80,577,767 (GRCm39)	missense	probably damaging	1.00
R7316:Ap3d1	UTSW	10	80,553,693 (GRCm39)	missense	probably damaging	1.00
R7325:Ap3d1	UTSW	10	80,559,637 (GRCm39)	missense	probably damaging	1.00
R7395:Ap3d1	UTSW	10	80,566,716 (GRCm39)	missense	probably benign	0.11
R7405:Ap3d1	UTSW	10	80,577,734 (GRCm39)	missense	probably benign	0.16
R7425:Ap3d1	UTSW	10	80,557,426 (GRCm39)	missense	probably damaging	1.00
R7558:Ap3d1	UTSW	10	80,558,755 (GRCm39)	missense	possibly damaging	0.92
R7583:Ap3d1	UTSW	10	80,545,292 (GRCm39)	missense	probably benign	0.13
R7703:Ap3d1	UTSW	10	80,553,678 (GRCm39)	missense	probably damaging	1.00
R7964:Ap3d1	UTSW	10	80,565,891 (GRCm39)	missense	probably damaging	1.00
R8021:Ap3d1	UTSW	10	80,550,135 (GRCm39)	missense	probably benign	0.30
R8200:Ap3d1	UTSW	10	80,558,766 (GRCm39)	nonsense	probably null
R8314:Ap3d1	UTSW	10	80,559,373 (GRCm39)	missense	possibly damaging	0.91
R8356:Ap3d1	UTSW	10	80,568,737 (GRCm39)	missense	probably damaging	1.00
R8896:Ap3d1	UTSW	10	80,552,425 (GRCm39)	missense	probably benign	0.01
R8936:Ap3d1	UTSW	10	80,547,952 (GRCm39)	missense	probably benign	0.02
R9183:Ap3d1	UTSW	10	80,545,627 (GRCm39)	missense	probably null	0.06
R9209:Ap3d1	UTSW	10	80,554,918 (GRCm39)	missense	probably benign	0.04
R9259:Ap3d1	UTSW	10	80,559,661 (GRCm39)	missense	probably damaging	1.00
R9476:Ap3d1	UTSW	10	80,545,655 (GRCm39)	missense	probably benign	0.00
R9645:Ap3d1	UTSW	10	80,545,062 (GRCm39)	missense	probably benign
R9664:Ap3d1	UTSW	10	80,548,639 (GRCm39)	missense	possibly damaging	0.71
R9781:Ap3d1	UTSW	10	80,545,609 (GRCm39)	missense	possibly damaging	0.51
X0019:Ap3d1	UTSW	10	80,554,936 (GRCm39)	missense	probably damaging	1.00
X0026:Ap3d1	UTSW	10	80,556,981 (GRCm39)	missense	possibly damaging	0.46
Z1088:Ap3d1	UTSW	10	80,555,071 (GRCm39)	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GAGAAGGCACTAACCTCTGGCATC -3'
(R):5'- CTTCCTCACAACTGTATGACAGGGC -3'

Sequencing Primer
(F):5'- cttctccttcttcttccttttcttg -3'
(R):5'- TGCAGCTTACCTTATGGGCAG -3'

Posted On

2014-01-05