Incidental Mutation 'R0968:Plekhm2'
ID 83943
Institutional Source Beutler Lab
Gene Symbol Plekhm2
Ensembl Gene ENSMUSG00000028917
Gene Name pleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms 2310034J19Rik
MMRRC Submission 039097-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0968 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 141353043-141391457 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 141357243 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 743 (V743A)
Ref Sequence ENSEMBL: ENSMUSP00000081221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030751] [ENSMUST00000084203]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000030751
AA Change: V723A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000030751
Gene: ENSMUSG00000028917
AA Change: V723A

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 230 246 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
low complexity region 485 495 N/A INTRINSIC
low complexity region 505 538 N/A INTRINSIC
Blast:PH 596 656 7e-31 BLAST
PH 766 869 2.43e-12 SMART
Blast:PH 879 960 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000084203
AA Change: V743A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000081221
Gene: ENSMUSG00000028917
AA Change: V743A

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 250 266 N/A INTRINSIC
low complexity region 315 327 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
low complexity region 525 558 N/A INTRINSIC
Blast:PH 616 676 7e-31 BLAST
PH 786 889 2.43e-12 SMART
Blast:PH 899 980 6e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150229
Meta Mutation Damage Score 0.0665 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency 94% (34/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the plus-end directed microtubule motor protein kinesin, together with the lysosomal GTPase Arl8, and is required for lysosomes to distribute away from the microtubule-organizing center. The encoded protein belongs to the multisubunit BLOC-one-related complex that regulates lysosome positioning. It binds a Salmonella effector protein called Salmonella induced filament A and is a critical host determinant in Salmonella pathogenesis. It has a domain architecture consisting of an N-terminal RPIP8, UNC-14, and NESCA (RUN) domain that binds kinesin-1 as well as the lysosomal GTPase Arl8, and a C-terminal pleckstrin homology domain that binds the Salmonella induced filament A effector protein. Naturally occurring mutations in this gene lead to abnormal localization of lysosomes, impaired autophagy flux and are associated with recessive dilated cardiomyopathy and left ventricular noncompaction. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased leukocyte numbers and decreased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 137,772,967 (GRCm39) V719M probably damaging Het
Abca13 A G 11: 9,248,016 (GRCm39) S2588G probably benign Het
Acaca C T 11: 84,129,859 (GRCm39) Q405* probably null Het
Brms1l G A 12: 55,912,798 (GRCm39) D264N possibly damaging Het
Cabcoco1 T C 10: 68,272,202 (GRCm39) M254V probably benign Het
Cndp1 G A 18: 84,652,777 (GRCm39) probably benign Het
Coro7 G C 16: 4,487,919 (GRCm39) probably benign Het
Cylc2 A G 4: 51,216,706 (GRCm39) M1V probably null Het
Cyp3a11 G A 5: 145,799,324 (GRCm39) probably benign Het
Dnah10 C T 5: 124,906,641 (GRCm39) T4224M probably damaging Het
Dnah2 T C 11: 69,339,345 (GRCm39) E3054G possibly damaging Het
Dnm3 A G 1: 161,847,388 (GRCm39) probably benign Het
Efcab5 G A 11: 77,031,749 (GRCm39) R42W probably damaging Het
Fgf12 T C 16: 27,981,185 (GRCm39) N177S probably null Het
Flt3 C T 5: 147,278,037 (GRCm39) V846I possibly damaging Het
Gm11569 A T 11: 99,689,250 (GRCm39) probably benign Het
Gm12695 A C 4: 96,650,303 (GRCm39) V181G probably damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Lars1 C A 18: 42,351,648 (GRCm39) R852L probably benign Het
Lca5 T C 9: 83,305,222 (GRCm39) T195A probably benign Het
Lrrc40 G A 3: 157,742,426 (GRCm39) D14N probably damaging Het
Map4k2 T C 19: 6,395,487 (GRCm39) S327P probably damaging Het
Mpp4 A G 1: 59,169,249 (GRCm39) F397L probably damaging Het
Mtus2 T C 5: 148,014,994 (GRCm39) S596P probably benign Het
Myo3a T A 2: 22,448,301 (GRCm39) N25K probably damaging Het
Nadsyn1 T C 7: 143,359,770 (GRCm39) T401A probably benign Het
Pde6a A T 18: 61,386,809 (GRCm39) E395D probably damaging Het
Pzp A T 6: 128,502,108 (GRCm39) D80E probably benign Het
Rp1 A T 1: 4,415,575 (GRCm39) C1846S probably benign Het
Shbg A G 11: 69,508,014 (GRCm39) L117P probably damaging Het
Slc35e1 T C 8: 73,246,415 (GRCm39) probably benign Het
Slc5a2 G C 7: 127,869,803 (GRCm39) R412P probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Supt20 A G 3: 54,615,821 (GRCm39) probably benign Het
Vcpip1 A T 1: 9,816,604 (GRCm39) I593N probably damaging Het
Other mutations in Plekhm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Plekhm2 APN 4 141,369,956 (GRCm39) splice site probably null
IGL01388:Plekhm2 APN 4 141,369,312 (GRCm39) missense probably damaging 1.00
IGL01392:Plekhm2 APN 4 141,369,737 (GRCm39) missense probably damaging 0.98
IGL01482:Plekhm2 APN 4 141,357,340 (GRCm39) missense probably damaging 0.98
IGL01828:Plekhm2 APN 4 141,356,896 (GRCm39) missense probably benign 0.11
IGL02010:Plekhm2 APN 4 141,364,730 (GRCm39) splice site probably benign
IGL02075:Plekhm2 APN 4 141,355,617 (GRCm39) missense probably benign 0.38
IGL02381:Plekhm2 APN 4 141,370,034 (GRCm39) missense possibly damaging 0.95
IGL02543:Plekhm2 APN 4 141,369,330 (GRCm39) missense probably benign 0.02
IGL02747:Plekhm2 APN 4 141,361,583 (GRCm39) missense possibly damaging 0.55
IGL02802:Plekhm2 APN 4 141,369,835 (GRCm39) splice site probably benign
IGL02828:Plekhm2 APN 4 141,356,941 (GRCm39) missense probably damaging 1.00
IGL03286:Plekhm2 APN 4 141,361,658 (GRCm39) missense possibly damaging 0.95
R0008:Plekhm2 UTSW 4 141,369,704 (GRCm39) splice site probably benign
R0008:Plekhm2 UTSW 4 141,369,704 (GRCm39) splice site probably benign
R0639:Plekhm2 UTSW 4 141,369,381 (GRCm39) missense probably damaging 1.00
R0682:Plekhm2 UTSW 4 141,355,436 (GRCm39) missense probably damaging 0.97
R1109:Plekhm2 UTSW 4 141,355,295 (GRCm39) missense probably benign 0.31
R1475:Plekhm2 UTSW 4 141,355,165 (GRCm39) missense possibly damaging 0.75
R1802:Plekhm2 UTSW 4 141,361,658 (GRCm39) missense probably benign 0.03
R1813:Plekhm2 UTSW 4 141,369,750 (GRCm39) missense possibly damaging 0.93
R1844:Plekhm2 UTSW 4 141,359,685 (GRCm39) missense probably benign
R2261:Plekhm2 UTSW 4 141,370,043 (GRCm39) missense probably damaging 0.98
R3889:Plekhm2 UTSW 4 141,369,301 (GRCm39) splice site probably benign
R3922:Plekhm2 UTSW 4 141,356,843 (GRCm39) missense probably benign 0.01
R4324:Plekhm2 UTSW 4 141,359,168 (GRCm39) missense possibly damaging 0.86
R4758:Plekhm2 UTSW 4 141,369,316 (GRCm39) missense possibly damaging 0.91
R4814:Plekhm2 UTSW 4 141,355,150 (GRCm39) missense probably benign 0.00
R4983:Plekhm2 UTSW 4 141,361,687 (GRCm39) missense probably damaging 1.00
R5468:Plekhm2 UTSW 4 141,355,411 (GRCm39) missense probably damaging 1.00
R5691:Plekhm2 UTSW 4 141,355,600 (GRCm39) missense possibly damaging 0.96
R5877:Plekhm2 UTSW 4 141,367,004 (GRCm39) missense probably damaging 0.98
R6268:Plekhm2 UTSW 4 141,359,652 (GRCm39) nonsense probably null
R6367:Plekhm2 UTSW 4 141,367,016 (GRCm39) missense probably damaging 0.97
R6371:Plekhm2 UTSW 4 141,356,843 (GRCm39) missense possibly damaging 0.94
R6489:Plekhm2 UTSW 4 141,359,344 (GRCm39) missense probably damaging 1.00
R7266:Plekhm2 UTSW 4 141,369,770 (GRCm39) missense possibly damaging 0.91
R7399:Plekhm2 UTSW 4 141,361,687 (GRCm39) missense probably damaging 1.00
R7573:Plekhm2 UTSW 4 141,358,658 (GRCm39) missense probably benign 0.02
R7742:Plekhm2 UTSW 4 141,355,150 (GRCm39) missense probably benign 0.00
R7864:Plekhm2 UTSW 4 141,355,357 (GRCm39) missense probably damaging 0.96
R7920:Plekhm2 UTSW 4 141,359,432 (GRCm39) missense probably damaging 1.00
R8417:Plekhm2 UTSW 4 141,355,136 (GRCm39) missense probably benign 0.04
R8462:Plekhm2 UTSW 4 141,367,130 (GRCm39) missense probably damaging 1.00
R8504:Plekhm2 UTSW 4 141,369,764 (GRCm39) missense probably damaging 1.00
R8851:Plekhm2 UTSW 4 141,358,639 (GRCm39) missense probably benign 0.04
R8855:Plekhm2 UTSW 4 141,361,658 (GRCm39) missense probably benign 0.03
R9051:Plekhm2 UTSW 4 141,359,732 (GRCm39) missense possibly damaging 0.50
R9080:Plekhm2 UTSW 4 141,359,039 (GRCm39) missense probably damaging 1.00
R9252:Plekhm2 UTSW 4 141,356,443 (GRCm39) missense probably damaging 1.00
R9298:Plekhm2 UTSW 4 141,356,829 (GRCm39) missense probably benign
R9383:Plekhm2 UTSW 4 141,359,612 (GRCm39) missense probably damaging 1.00
R9463:Plekhm2 UTSW 4 141,357,949 (GRCm39) missense probably benign 0.10
T0722:Plekhm2 UTSW 4 141,359,292 (GRCm39) small deletion probably benign
T0975:Plekhm2 UTSW 4 141,359,292 (GRCm39) small deletion probably benign
X0024:Plekhm2 UTSW 4 141,355,352 (GRCm39) missense probably damaging 1.00
Z1177:Plekhm2 UTSW 4 141,367,133 (GRCm39) missense possibly damaging 0.73
Z1177:Plekhm2 UTSW 4 141,356,396 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AGCCCATAGAAATGCACGGTCACG -3'
(R):5'- TCACACCTATCTGCCAAGGACCTG -3'

Sequencing Primer
(F):5'- TGAGACTTTGGCAAAGCCC -3'
(R):5'- GCCAAGGACCTGTCCCC -3'
Posted On 2013-11-08