Incidental Mutation 'R0840:Cntnap3'
ID 77133
Institutional Source Beutler Lab
Gene Symbol Cntnap3
Ensembl Gene ENSMUSG00000033063
Gene Name contactin associated protein-like 3
Synonyms
MMRRC Submission 039019-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R0840 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 64883996-65051769 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 64935724 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 380 (S380G)
Ref Sequence ENSEMBL: ENSMUSP00000089140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091554]
AlphaFold E9PY62
Predicted Effect possibly damaging
Transcript: ENSMUST00000091554
AA Change: S380G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: S380G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
FA58C 33 180 4.88e-17 SMART
LamG 207 345 1.47e-11 SMART
LamG 394 525 1.43e-23 SMART
EGF 553 587 1.33e-1 SMART
FBG 590 775 6.76e-1 SMART
LamG 815 942 1.89e-32 SMART
EGF_like 963 999 6.28e1 SMART
LamG 1040 1178 9.46e-15 SMART
transmembrane domain 1245 1267 N/A INTRINSIC
Meta Mutation Damage Score 0.0929 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik C G 12: 71,205,657 (GRCm39) Q434E probably benign Het
A930011G23Rik T C 5: 99,382,547 (GRCm39) T234A probably benign Het
Acot5 G A 12: 84,122,614 (GRCm39) W399* probably null Het
Adra1a A G 14: 66,965,159 (GRCm39) E383G possibly damaging Het
Ahnak T A 19: 8,982,427 (GRCm39) I1237N probably damaging Het
Bsg A G 10: 79,545,519 (GRCm39) T28A probably damaging Het
Cacna1i A T 15: 80,243,150 (GRCm39) I436F possibly damaging Het
Cd109 T C 9: 78,571,612 (GRCm39) I417T probably benign Het
Cep295 A T 9: 15,245,611 (GRCm39) D948E probably benign Het
Cfap92 G T 6: 87,657,260 (GRCm39) noncoding transcript Het
Clcn3 C A 8: 61,382,188 (GRCm39) V467F probably benign Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dll4 T A 2: 119,156,966 (GRCm39) N79K probably benign Het
Ep300 A T 15: 81,529,134 (GRCm39) N1558I unknown Het
Fblim1 A G 4: 141,308,320 (GRCm39) F330L possibly damaging Het
Fbxo46 T A 7: 18,871,073 (GRCm39) M564K possibly damaging Het
Fnip1 T A 11: 54,384,007 (GRCm39) probably benign Het
Foxl2 A T 9: 98,837,984 (GRCm39) K91* probably null Het
Gapvd1 C A 2: 34,619,125 (GRCm39) V83F probably benign Het
Guk1 G A 11: 59,075,921 (GRCm39) R146C probably damaging Het
Irf8 G A 8: 121,480,220 (GRCm39) G153S probably benign Het
Kcnu1 T A 8: 26,403,712 (GRCm39) M1K probably null Het
Krt32 G A 11: 99,972,068 (GRCm39) P427S probably benign Het
Lrp12 A G 15: 39,739,554 (GRCm39) S529P probably damaging Het
Mettl22 T C 16: 8,300,021 (GRCm39) V134A probably damaging Het
Morc2b G T 17: 33,355,086 (GRCm39) H895Q probably benign Het
Nrros T C 16: 31,962,241 (GRCm39) D556G probably damaging Het
Nrxn3 A G 12: 90,298,567 (GRCm39) S1367G possibly damaging Het
Or10al7 A G 17: 38,366,463 (GRCm39) F7S probably benign Het
Or56b1b A T 7: 108,164,823 (GRCm39) S60T probably benign Het
Pcnx3 T A 19: 5,735,729 (GRCm39) probably null Het
Pgap2 A T 7: 101,886,655 (GRCm39) M226L probably damaging Het
Pik3c2g A G 6: 139,841,798 (GRCm39) I616M probably damaging Het
Pisd A G 5: 32,894,656 (GRCm39) I380T probably damaging Het
Pkhd1 T C 1: 20,420,745 (GRCm39) I2454V probably damaging Het
Plpp2 A G 10: 79,363,378 (GRCm39) I151T probably benign Het
Polr3a G A 14: 24,502,268 (GRCm39) T1295I possibly damaging Het
Pot1a T C 6: 25,748,283 (GRCm39) probably benign Het
Prpf39 T G 12: 65,094,980 (GRCm39) N219K probably benign Het
Rnf17 T A 14: 56,712,904 (GRCm39) N790K probably damaging Het
Slit3 C T 11: 35,514,263 (GRCm39) probably benign Het
Stx1a T A 5: 135,070,088 (GRCm39) probably benign Het
Tenm3 C A 8: 48,788,777 (GRCm39) V690F probably damaging Het
Tmcc3 A G 10: 94,414,633 (GRCm39) I143V probably benign Het
Tmem41b G A 7: 109,580,256 (GRCm39) S36F probably damaging Het
Trim5 A T 7: 103,914,978 (GRCm39) W364R probably damaging Het
Ttn T C 2: 76,617,155 (GRCm39) Y16403C probably damaging Het
Vps8 T C 16: 21,275,071 (GRCm39) S210P probably damaging Het
Zbtb3 T A 19: 8,780,821 (GRCm39) S145T possibly damaging Het
Zfp882 T A 8: 72,668,530 (GRCm39) C452* probably null Het
Other mutations in Cntnap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Cntnap3 APN 13 64,920,545 (GRCm39) missense probably damaging 1.00
IGL00782:Cntnap3 APN 13 64,893,619 (GRCm39) splice site probably benign
IGL00976:Cntnap3 APN 13 64,942,166 (GRCm39) missense probably damaging 1.00
IGL01319:Cntnap3 APN 13 64,935,651 (GRCm39) missense probably damaging 1.00
IGL01610:Cntnap3 APN 13 64,905,115 (GRCm39) missense probably damaging 0.98
IGL01861:Cntnap3 APN 13 64,946,922 (GRCm39) missense probably damaging 1.00
IGL02127:Cntnap3 APN 13 64,946,878 (GRCm39) splice site probably benign
IGL02133:Cntnap3 APN 13 64,899,487 (GRCm39) splice site probably benign
IGL02251:Cntnap3 APN 13 64,909,850 (GRCm39) missense probably damaging 1.00
IGL02272:Cntnap3 APN 13 64,905,225 (GRCm39) missense probably damaging 1.00
IGL02370:Cntnap3 APN 13 64,899,565 (GRCm39) missense probably benign
IGL02456:Cntnap3 APN 13 64,946,872 (GRCm39) splice site probably benign
IGL02589:Cntnap3 APN 13 64,940,244 (GRCm39) missense probably benign 0.08
IGL02695:Cntnap3 APN 13 64,919,946 (GRCm39) missense probably benign 0.01
IGL02850:Cntnap3 APN 13 64,905,223 (GRCm39) missense probably damaging 1.00
IGL03038:Cntnap3 APN 13 64,888,839 (GRCm39) missense possibly damaging 0.50
IGL03188:Cntnap3 APN 13 64,929,559 (GRCm39) missense probably damaging 0.97
IGL03327:Cntnap3 APN 13 65,035,582 (GRCm39) nonsense probably null
PIT4480001:Cntnap3 UTSW 13 64,905,024 (GRCm39) missense probably damaging 1.00
R0309:Cntnap3 UTSW 13 64,905,250 (GRCm39) splice site probably benign
R0422:Cntnap3 UTSW 13 64,905,099 (GRCm39) missense probably damaging 0.96
R0463:Cntnap3 UTSW 13 64,926,690 (GRCm39) missense probably damaging 1.00
R0491:Cntnap3 UTSW 13 64,909,859 (GRCm39) missense probably benign 0.01
R0499:Cntnap3 UTSW 13 65,006,492 (GRCm39) missense probably benign 0.33
R0550:Cntnap3 UTSW 13 64,909,814 (GRCm39) missense possibly damaging 0.86
R0613:Cntnap3 UTSW 13 64,906,228 (GRCm39) missense probably damaging 1.00
R0666:Cntnap3 UTSW 13 64,905,211 (GRCm39) missense probably damaging 1.00
R1577:Cntnap3 UTSW 13 64,906,104 (GRCm39) missense probably damaging 1.00
R1716:Cntnap3 UTSW 13 64,909,816 (GRCm39) missense probably damaging 1.00
R1732:Cntnap3 UTSW 13 64,888,626 (GRCm39) critical splice donor site probably null
R1739:Cntnap3 UTSW 13 64,888,406 (GRCm39) missense probably benign 0.17
R1905:Cntnap3 UTSW 13 65,051,578 (GRCm39) missense probably benign 0.04
R1988:Cntnap3 UTSW 13 64,906,204 (GRCm39) missense probably damaging 1.00
R2086:Cntnap3 UTSW 13 64,942,076 (GRCm39) missense possibly damaging 0.76
R3732:Cntnap3 UTSW 13 64,888,813 (GRCm39) missense possibly damaging 0.73
R3808:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R3809:Cntnap3 UTSW 13 64,929,618 (GRCm39) missense probably damaging 0.96
R4384:Cntnap3 UTSW 13 64,896,274 (GRCm39) missense probably damaging 1.00
R4433:Cntnap3 UTSW 13 64,926,667 (GRCm39) missense possibly damaging 0.92
R4631:Cntnap3 UTSW 13 64,926,697 (GRCm39) missense probably benign 0.04
R4645:Cntnap3 UTSW 13 64,926,602 (GRCm39) critical splice donor site probably null
R4702:Cntnap3 UTSW 13 64,926,676 (GRCm39) missense probably benign 0.17
R4876:Cntnap3 UTSW 13 64,935,520 (GRCm39) missense probably benign 0.00
R4994:Cntnap3 UTSW 13 64,909,798 (GRCm39) missense possibly damaging 0.55
R5043:Cntnap3 UTSW 13 64,942,162 (GRCm39) missense probably damaging 1.00
R5214:Cntnap3 UTSW 13 64,909,824 (GRCm39) missense probably damaging 1.00
R5403:Cntnap3 UTSW 13 64,909,792 (GRCm39) missense possibly damaging 0.90
R5571:Cntnap3 UTSW 13 65,051,572 (GRCm39) missense probably damaging 0.98
R5587:Cntnap3 UTSW 13 64,894,552 (GRCm39) missense probably damaging 1.00
R5695:Cntnap3 UTSW 13 64,935,769 (GRCm39) missense probably damaging 0.99
R5834:Cntnap3 UTSW 13 64,896,391 (GRCm39) missense probably benign 0.07
R5892:Cntnap3 UTSW 13 64,946,994 (GRCm39) missense probably damaging 1.00
R5950:Cntnap3 UTSW 13 64,935,583 (GRCm39) missense probably damaging 1.00
R6526:Cntnap3 UTSW 13 64,929,702 (GRCm39) missense possibly damaging 0.96
R6954:Cntnap3 UTSW 13 64,896,373 (GRCm39) missense probably benign 0.00
R7138:Cntnap3 UTSW 13 64,929,539 (GRCm39) critical splice donor site probably null
R7355:Cntnap3 UTSW 13 64,919,776 (GRCm39) missense probably benign
R7425:Cntnap3 UTSW 13 64,906,066 (GRCm39) missense probably damaging 1.00
R7521:Cntnap3 UTSW 13 64,919,815 (GRCm39) missense probably benign 0.22
R7719:Cntnap3 UTSW 13 64,920,591 (GRCm39) nonsense probably null
R7810:Cntnap3 UTSW 13 64,941,122 (GRCm39) missense possibly damaging 0.73
R7871:Cntnap3 UTSW 13 65,051,587 (GRCm39) missense probably benign 0.00
R8259:Cntnap3 UTSW 13 64,935,681 (GRCm39) missense probably damaging 0.99
R8415:Cntnap3 UTSW 13 64,886,479 (GRCm39) missense probably benign 0.31
R8491:Cntnap3 UTSW 13 64,933,157 (GRCm39) missense probably damaging 1.00
R9086:Cntnap3 UTSW 13 64,929,573 (GRCm39) missense probably damaging 1.00
R9087:Cntnap3 UTSW 13 64,899,532 (GRCm39) missense probably damaging 0.96
R9398:Cntnap3 UTSW 13 65,051,648 (GRCm39) missense probably benign 0.41
R9475:Cntnap3 UTSW 13 64,946,949 (GRCm39) missense probably damaging 1.00
R9625:Cntnap3 UTSW 13 65,006,579 (GRCm39) missense probably damaging 1.00
R9679:Cntnap3 UTSW 13 64,899,562 (GRCm39) missense probably damaging 1.00
Z1176:Cntnap3 UTSW 13 64,940,202 (GRCm39) missense probably damaging 0.98
Z1176:Cntnap3 UTSW 13 64,888,686 (GRCm39) frame shift probably null
Z1177:Cntnap3 UTSW 13 64,929,706 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAGGAGAGATCAAACCCATGTCTTCAA -3'
(R):5'- catctcaccatcccACAACAGGATTAAA -3'

Sequencing Primer
(F):5'- ACAGAACGACTCTGAGTTCTCTTG -3'
(R):5'- ccatcccACAACAGGATTAAAAATAC -3'
Posted On 2013-10-16