Incidental Mutation 'R0787:Hltf'
ID 76891
Institutional Source Beutler Lab
Gene Symbol Hltf
Ensembl Gene ENSMUSG00000002428
Gene Name helicase-like transcription factor
Synonyms Snf2l3, Smarca3, P113
MMRRC Submission 038967-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0787 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 20111975-20172654 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20160610 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 759 (D759V)
Ref Sequence ENSEMBL: ENSMUSP00000002502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002502] [ENSMUST00000143005] [ENSMUST00000145853]
AlphaFold Q6PCN7
Predicted Effect probably damaging
Transcript: ENSMUST00000002502
AA Change: D759V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002502
Gene: ENSMUSG00000002428
AA Change: D759V

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 608 1.26e-32 SMART
RING 754 794 4.41e-6 SMART
low complexity region 814 828 N/A INTRINSIC
HELICc 859 944 2.24e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128127
Predicted Effect probably benign
Transcript: ENSMUST00000143005
SMART Domains Protein: ENSMUSP00000116570
Gene: ENSMUSG00000002428

DomainStartEndE-ValueType
HIRAN 60 154 3.78e-29 SMART
DEXDc 236 610 2.36e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145853
SMART Domains Protein: ENSMUSP00000118775
Gene: ENSMUSG00000002428

DomainStartEndE-ValueType
HIRAN 1 92 2.7e-25 SMART
DEXDc 174 548 2.36e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155635
Meta Mutation Damage Score 0.7435 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein contains a RING finger DNA binding motif. Two transcript variants encoding the same protein have been found for this gene. However, use of an alternative translation start site produces an isoform that is truncated at the N-terminus compared to the full-length protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, spongiform encephalopathy with increased brain apoptosis, and hypoglycemia. Mice homozygous for a different knock-out allele fail to show fluoxetine-induced neurogenesis and behavioral responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001F09Rik A T 14: 43,202,950 (GRCm39) probably null Het
Abca8a T A 11: 109,933,814 (GRCm39) Y1197F possibly damaging Het
Abcc2 T C 19: 43,786,955 (GRCm39) probably null Het
Adamts16 A T 13: 70,886,948 (GRCm39) C979S probably damaging Het
Agap2 T A 10: 126,921,019 (GRCm39) D523E unknown Het
Ankfy1 T A 11: 72,651,122 (GRCm39) I1024N probably damaging Het
Ankrd13c A G 3: 157,700,315 (GRCm39) S379G probably null Het
Arhgap40 T C 2: 158,389,710 (GRCm39) S625P probably benign Het
Armc12 G C 17: 28,757,740 (GRCm39) A291P probably damaging Het
Armc9 A G 1: 86,130,227 (GRCm39) N524D probably damaging Het
Col12a1 G T 9: 79,545,767 (GRCm39) T2305K probably damaging Het
Cyp2c54 T C 19: 40,036,079 (GRCm39) N277S probably benign Het
Czib T A 4: 107,747,326 (GRCm39) L6Q probably damaging Het
Dennd2b G T 7: 109,124,827 (GRCm39) R1068S possibly damaging Het
E130311K13Rik A T 3: 63,827,719 (GRCm39) V129E probably benign Het
Ehbp1l1 T C 19: 5,772,696 (GRCm39) D79G possibly damaging Het
Epb41l1 A G 2: 156,336,010 (GRCm39) E58G probably damaging Het
Fam217b T A 2: 178,062,702 (GRCm39) V222E probably benign Het
Fat1 T A 8: 45,493,592 (GRCm39) Y3913N probably damaging Het
Fgd4 A G 16: 16,241,765 (GRCm39) probably benign Het
Hsp90ab1 ACTTCTT ACTT 17: 45,880,425 (GRCm39) probably benign Het
Isg15 C T 4: 156,284,396 (GRCm39) R44H probably benign Het
Itga4 C T 2: 79,109,497 (GRCm39) T232I probably benign Het
Kntc1 C A 5: 123,934,167 (GRCm39) H1399Q probably benign Het
Lig1 A C 7: 13,032,995 (GRCm39) K499Q probably benign Het
Lrrn3 C A 12: 41,504,230 (GRCm39) C29F probably damaging Het
Mtmr10 T C 7: 63,950,363 (GRCm39) I136T possibly damaging Het
Naip1 A G 13: 100,562,604 (GRCm39) Y854H probably benign Het
Or6c201 T C 10: 128,969,395 (GRCm39) N81D possibly damaging Het
Pcdh9 G A 14: 94,124,193 (GRCm39) A659V possibly damaging Het
Phf20l1 T A 15: 66,487,479 (GRCm39) probably benign Het
Phgdh A G 3: 98,241,865 (GRCm39) V83A probably damaging Het
Pik3r1 A T 13: 101,827,031 (GRCm39) M326K probably benign Het
Pirb A T 7: 3,720,637 (GRCm39) L287Q probably benign Het
Pkd1l2 T C 8: 117,802,916 (GRCm39) D235G possibly damaging Het
Pkhd1l1 C A 15: 44,392,660 (GRCm39) P1665Q probably damaging Het
Ppp1r7 A G 1: 93,292,678 (GRCm39) T326A probably damaging Het
Prr22 A T 17: 57,078,072 (GRCm39) Y75F possibly damaging Het
Ptov1 A C 7: 44,514,894 (GRCm39) probably null Het
Rasal2 A G 1: 156,986,266 (GRCm39) S766P probably damaging Het
Shmt1 T C 11: 60,683,802 (GRCm39) T337A probably benign Het
Tbc1d4 A T 14: 101,686,645 (GRCm39) I1168N probably damaging Het
Tecpr2 T C 12: 110,912,777 (GRCm39) V1126A probably benign Het
Tep1 A T 14: 51,066,687 (GRCm39) S2304T possibly damaging Het
Tiam1 C A 16: 89,586,449 (GRCm39) R1446M probably damaging Het
Tmem87a T C 2: 120,200,965 (GRCm39) I425V probably benign Het
Ubr3 T C 2: 69,781,765 (GRCm39) probably benign Het
Ubxn7 T A 16: 32,200,581 (GRCm39) probably benign Het
Vmn2r13 A G 5: 109,304,713 (GRCm39) S573P probably damaging Het
Wdfy3 A T 5: 102,105,254 (GRCm39) V191E probably damaging Het
Zdhhc3 A T 9: 122,912,688 (GRCm39) C153* probably null Het
Zfp407 A T 18: 84,227,147 (GRCm39) V2154D probably damaging Het
Zfp407 A G 18: 84,227,471 (GRCm39) V2046A probably benign Het
Zfr T A 15: 12,140,634 (GRCm39) I227N unknown Het
Other mutations in Hltf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Hltf APN 3 20,159,796 (GRCm39) splice site probably benign
IGL01461:Hltf APN 3 20,154,103 (GRCm39) nonsense probably null
IGL01630:Hltf APN 3 20,137,068 (GRCm39) splice site probably benign
IGL01704:Hltf APN 3 20,137,910 (GRCm39) splice site probably benign
IGL02059:Hltf APN 3 20,160,621 (GRCm39) missense probably benign
IGL02105:Hltf APN 3 20,146,921 (GRCm39) missense probably damaging 1.00
IGL02156:Hltf APN 3 20,146,971 (GRCm39) missense possibly damaging 0.61
IGL02870:Hltf APN 3 20,154,037 (GRCm39) missense probably damaging 0.98
IGL02899:Hltf APN 3 20,153,981 (GRCm39) missense probably damaging 1.00
IGL02935:Hltf APN 3 20,123,215 (GRCm39) missense probably damaging 1.00
IGL02950:Hltf APN 3 20,130,736 (GRCm39) missense probably benign 0.07
IGL03082:Hltf APN 3 20,118,723 (GRCm39) splice site probably benign
snarky UTSW 3 20,163,651 (GRCm39) critical splice donor site probably null
R0068:Hltf UTSW 3 20,113,254 (GRCm39) missense probably damaging 1.00
R0905:Hltf UTSW 3 20,163,033 (GRCm39) critical splice donor site probably null
R0980:Hltf UTSW 3 20,145,665 (GRCm39) missense probably benign 0.00
R1741:Hltf UTSW 3 20,140,352 (GRCm39) missense probably damaging 1.00
R1748:Hltf UTSW 3 20,130,685 (GRCm39) missense probably benign 0.13
R1799:Hltf UTSW 3 20,159,855 (GRCm39) missense probably damaging 1.00
R1976:Hltf UTSW 3 20,160,610 (GRCm39) missense probably damaging 1.00
R2171:Hltf UTSW 3 20,113,245 (GRCm39) missense probably damaging 1.00
R2395:Hltf UTSW 3 20,146,906 (GRCm39) missense probably benign 0.41
R2444:Hltf UTSW 3 20,118,071 (GRCm39) missense possibly damaging 0.66
R3789:Hltf UTSW 3 20,123,211 (GRCm39) missense probably damaging 1.00
R3943:Hltf UTSW 3 20,146,908 (GRCm39) missense probably damaging 1.00
R4719:Hltf UTSW 3 20,118,865 (GRCm39) critical splice donor site probably null
R4793:Hltf UTSW 3 20,118,114 (GRCm39) missense possibly damaging 0.79
R5296:Hltf UTSW 3 20,162,276 (GRCm39) missense probably damaging 0.99
R5449:Hltf UTSW 3 20,123,247 (GRCm39) missense possibly damaging 0.92
R5492:Hltf UTSW 3 20,152,231 (GRCm39) splice site probably null
R6012:Hltf UTSW 3 20,113,098 (GRCm39) missense probably damaging 1.00
R6157:Hltf UTSW 3 20,130,660 (GRCm39) missense probably benign 0.13
R6254:Hltf UTSW 3 20,117,993 (GRCm39) missense possibly damaging 0.85
R6553:Hltf UTSW 3 20,126,558 (GRCm39) missense probably damaging 0.96
R6616:Hltf UTSW 3 20,163,651 (GRCm39) critical splice donor site probably null
R6696:Hltf UTSW 3 20,119,470 (GRCm39) splice site probably null
R6761:Hltf UTSW 3 20,137,996 (GRCm39) critical splice donor site probably null
R6781:Hltf UTSW 3 20,152,330 (GRCm39) missense probably benign 0.00
R7241:Hltf UTSW 3 20,119,556 (GRCm39) missense probably benign 0.07
R7356:Hltf UTSW 3 20,163,534 (GRCm39) missense probably damaging 1.00
R7453:Hltf UTSW 3 20,136,916 (GRCm39) missense possibly damaging 0.81
R7765:Hltf UTSW 3 20,145,647 (GRCm39) missense probably benign 0.02
R7978:Hltf UTSW 3 20,146,968 (GRCm39) missense probably damaging 1.00
R8299:Hltf UTSW 3 20,136,986 (GRCm39) missense possibly damaging 0.73
R8547:Hltf UTSW 3 20,152,291 (GRCm39) missense probably damaging 1.00
R8857:Hltf UTSW 3 20,159,825 (GRCm39) missense probably damaging 0.98
R8859:Hltf UTSW 3 20,119,566 (GRCm39) nonsense probably null
R8926:Hltf UTSW 3 20,123,323 (GRCm39) critical splice donor site probably null
R8959:Hltf UTSW 3 20,136,936 (GRCm39) missense probably damaging 1.00
R9052:Hltf UTSW 3 20,152,246 (GRCm39) missense probably damaging 1.00
R9214:Hltf UTSW 3 20,140,280 (GRCm39) missense probably benign 0.01
R9405:Hltf UTSW 3 20,137,094 (GRCm39) missense possibly damaging 0.88
R9565:Hltf UTSW 3 20,136,996 (GRCm39) critical splice donor site probably null
X0027:Hltf UTSW 3 20,121,553 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTGTATGCTGCTAGTGTGGCAGAT -3'
(R):5'- TCTCTGGAACGTGGCTGGGT -3'

Sequencing Primer
(F):5'- GGCATGATTTCTGCAAATACCAG -3'
(R):5'- TGGCTGGGTTTTTATTATACCAAAG -3'
Posted On 2013-10-16