Incidental Mutation 'R0095:Fer'
ID 64044
Institutional Source Beutler Lab
Gene Symbol Fer
Ensembl Gene ENSMUSG00000000127
Gene Name FER tyrosine kinase
Synonyms C330004K01Rik, Fert, Fert2
MMRRC Submission 038381-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0095 (G1)
Quality Score 140
Status Not validated
Chromosome 17
Chromosomal Location 64170057-64446491 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 64248321 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 361 (E361V)
Ref Sequence ENSEMBL: ENSMUSP00000000129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000129] [ENSMUST00000038080]
AlphaFold P70451
Predicted Effect possibly damaging
Transcript: ENSMUST00000000129
AA Change: E361V

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000000129
Gene: ENSMUSG00000000127
AA Change: E361V

DomainStartEndE-ValueType
FCH 1 92 1.29e-27 SMART
coiled coil region 123 174 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
coiled coil region 308 381 N/A INTRINSIC
SH2 459 538 5.9e-30 SMART
TyrKc 564 815 6.69e-148 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038080
SMART Domains Protein: ENSMUSP00000037418
Gene: ENSMUSG00000000127

DomainStartEndE-ValueType
SH2 89 168 5.9e-30 SMART
TyrKc 194 445 6.69e-148 SMART
Meta Mutation Damage Score 0.0626 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the FPS/FES family of non-transmembrane receptor tyrosine kinases. It regulates cell-cell adhesion and mediates signaling from the cell surface to the cytoskeleton via growth factor receptors. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome X. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a targeted mutation exhibit elevated lipopolysaccharide-induced leukocyte adhesion and migration. Mutant cells also exhibit reduced phosphorylation of cortactin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 18 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa8 G A 14: 33,808,028 (GRCm39) A6T probably benign Het
Bicc1 T A 10: 70,796,988 (GRCm39) I42F probably damaging Het
Cutc T C 19: 43,741,638 (GRCm39) W13R probably benign Het
F5 A T 1: 164,019,537 (GRCm39) R671* probably null Het
Hnrnpa3 G T 2: 75,492,040 (GRCm39) R52L probably damaging Het
Igsf10 A T 3: 59,238,617 (GRCm39) Y521* probably null Het
Lratd2 T C 15: 60,695,425 (GRCm39) Y107C probably damaging Het
Mmp1a G A 9: 7,465,621 (GRCm39) G186D possibly damaging Het
Naip1 T C 13: 100,559,591 (GRCm39) T1138A probably benign Het
Necab1 T A 4: 14,960,027 (GRCm39) N307Y possibly damaging Het
Or5p81 A C 7: 108,267,252 (GRCm39) I210L probably benign Het
Plekha5 T C 6: 140,474,323 (GRCm39) F84L probably damaging Het
Rpl6 T G 5: 121,343,902 (GRCm39) V115G possibly damaging Het
Sec16a A T 2: 26,315,772 (GRCm39) probably null Het
Tpsg1 T C 17: 25,591,528 (GRCm39) W43R probably damaging Het
Unc45a T C 7: 79,979,291 (GRCm39) D567G probably damaging Het
Usp30 T A 5: 114,243,901 (GRCm39) F157I probably damaging Het
Zfp345 T A 2: 150,314,220 (GRCm39) H439L probably damaging Het
Other mutations in Fer
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Fer APN 17 64,344,621 (GRCm39) missense probably damaging 1.00
IGL02004:Fer APN 17 64,231,174 (GRCm39) critical splice donor site probably null
IGL02103:Fer APN 17 64,445,923 (GRCm39) missense probably benign 0.02
IGL02157:Fer APN 17 64,445,894 (GRCm39) missense probably benign 0.03
IGL02217:Fer APN 17 64,445,960 (GRCm39) missense probably benign 0.00
IGL02376:Fer APN 17 64,241,341 (GRCm39) missense possibly damaging 0.69
IGL02955:Fer APN 17 64,298,712 (GRCm39) critical splice donor site probably null
IGL02967:Fer APN 17 64,203,262 (GRCm39) missense possibly damaging 0.69
IGL03392:Fer APN 17 64,298,637 (GRCm39) missense probably damaging 0.97
R0095:Fer UTSW 17 64,248,321 (GRCm39) missense possibly damaging 0.51
R0207:Fer UTSW 17 64,203,273 (GRCm39) missense probably damaging 1.00
R0243:Fer UTSW 17 64,385,941 (GRCm39) missense probably benign 0.00
R0309:Fer UTSW 17 64,446,011 (GRCm39) makesense probably null
R0384:Fer UTSW 17 64,231,179 (GRCm39) splice site probably benign
R0634:Fer UTSW 17 64,342,503 (GRCm39) missense probably benign 0.40
R1885:Fer UTSW 17 64,445,909 (GRCm39) missense probably damaging 0.96
R1939:Fer UTSW 17 64,280,123 (GRCm39) missense probably damaging 1.00
R2427:Fer UTSW 17 64,264,298 (GRCm39) missense probably benign
R2504:Fer UTSW 17 64,298,575 (GRCm39) splice site probably null
R4301:Fer UTSW 17 64,385,905 (GRCm39) missense probably damaging 1.00
R4404:Fer UTSW 17 64,248,284 (GRCm39) critical splice acceptor site probably null
R4418:Fer UTSW 17 64,336,286 (GRCm39) missense possibly damaging 0.89
R4812:Fer UTSW 17 64,241,292 (GRCm39) missense probably benign
R5561:Fer UTSW 17 64,344,580 (GRCm39) nonsense probably null
R5724:Fer UTSW 17 64,231,152 (GRCm39) missense probably damaging 1.00
R5936:Fer UTSW 17 64,231,058 (GRCm39) missense probably benign
R6157:Fer UTSW 17 64,385,880 (GRCm39) missense probably damaging 1.00
R6848:Fer UTSW 17 64,298,601 (GRCm39) missense probably damaging 1.00
R7175:Fer UTSW 17 64,231,090 (GRCm39) missense probably benign 0.01
R7198:Fer UTSW 17 64,228,683 (GRCm39) missense possibly damaging 0.84
R7438:Fer UTSW 17 64,440,516 (GRCm39) missense possibly damaging 0.91
R7723:Fer UTSW 17 64,203,273 (GRCm39) missense probably damaging 1.00
R7949:Fer UTSW 17 64,440,503 (GRCm39) missense probably damaging 1.00
R8064:Fer UTSW 17 64,214,418 (GRCm39) missense probably benign 0.04
R8472:Fer UTSW 17 64,280,144 (GRCm39) missense probably benign 0.00
R9032:Fer UTSW 17 64,228,767 (GRCm39) missense probably damaging 0.99
R9085:Fer UTSW 17 64,228,767 (GRCm39) missense probably damaging 0.99
R9358:Fer UTSW 17 64,280,076 (GRCm39) missense possibly damaging 0.79
R9452:Fer UTSW 17 64,231,067 (GRCm39) missense probably benign
R9608:Fer UTSW 17 64,214,327 (GRCm39) missense probably benign
R9747:Fer UTSW 17 64,214,376 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GTTCCTAACCCTAACGTCTGCTGTG -3'
(R):5'- TGACCTGAGGTGACTGACTGGTAAG -3'

Sequencing Primer
(F):5'- acagatacatacacagacgcac -3'
(R):5'- ACTGACTGGTAAGTCTATTCTGC -3'
Posted On 2013-08-06