Incidental Mutation 'R6992:Klhl6'
ID543932
Institutional Source Beutler Lab
Gene Symbol Klhl6
Ensembl Gene ENSMUSG00000043008
Gene Namekelch-like 6
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6992 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location19946496-19983037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19953587 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 336 (T336N)
Ref Sequence ENSEMBL: ENSMUSP00000053023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058839]
Predicted Effect probably damaging
Transcript: ENSMUST00000058839
AA Change: T336N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053023
Gene: ENSMUSG00000043008
AA Change: T336N

DomainStartEndE-ValueType
BTB 70 167 1.43e-25 SMART
BACK 172 274 1.68e-35 SMART
Kelch 376 419 3.05e-1 SMART
Kelch 420 466 6.82e-11 SMART
Kelch 467 514 4.27e-3 SMART
Kelch 515 556 3.06e-4 SMART
Kelch 557 604 3.47e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-like (KLHL) family of proteins, which is involved in B-lymphocyte antigen receptor signaling and germinal-center B-cell maturation. The encoded protein contains an N-terminal broad-complex, tramtrack and bric a brac (BTB) domain that facilitates protein binding and dimerization, a BTB and C-terminal kelch (BACK) domain, and six C-terminal kelch repeat domains. Naturally occurring mutations in this gene are associated with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spleen hypoplasia, defects in mature B-cell subsets with normal pro- and pre-B-cell development, severely impaired antigen-dependent germinal center formation, and reduced memory IgG response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik T C 9: 92,354,672 M128T probably benign Het
4921539E11Rik C T 4: 103,242,793 S171N possibly damaging Het
6030468B19Rik T G 11: 117,797,768 M1R probably null Het
9530053A07Rik T A 7: 28,140,183 F474I probably benign Het
A730049H05Rik T C 6: 92,827,994 probably benign Het
AC125199.3 G T 16: 88,812,027 H52Q possibly damaging Het
Adam34 A T 8: 43,652,605 M1K probably null Het
Adgrf5 T C 17: 43,452,323 probably null Het
Antxr2 T C 5: 97,960,705 T316A probably benign Het
Cc2d1a A T 8: 84,134,913 V714D probably damaging Het
Cd96 A G 16: 46,049,724 S461P possibly damaging Het
Cdc16 C A 8: 13,759,188 A51E probably benign Het
Chd4 T A 6: 125,114,376 D1243E probably benign Het
Cntf A T 19: 12,765,333 I21N probably damaging Het
Col11a2 C T 17: 34,047,144 A282V probably benign Het
Col14a1 T A 15: 55,411,562 probably null Het
Cyp2b9 T C 7: 26,201,139 Y401H probably benign Het
Dlgap4 A G 2: 156,748,940 probably null Het
Fancd2 T C 6: 113,571,018 probably null Het
Frem1 A G 4: 82,940,362 V1622A possibly damaging Het
Golm1 ACTTCTTCT ACTTCT 13: 59,649,576 probably benign Het
Gstm4 A G 3: 108,044,665 M3T possibly damaging Het
Hdac10 T C 15: 89,125,331 D466G probably benign Het
Hook2 A G 8: 85,002,556 E625G probably damaging Het
Hspbp1 G C 7: 4,664,715 P260A probably benign Het
Igdcc3 C A 9: 65,181,571 Q411K probably damaging Het
Il18rap G A 1: 40,542,035 E356K probably benign Het
Inpp4a A T 1: 37,389,691 M699L probably damaging Het
Klhdc1 A G 12: 69,253,757 H157R probably damaging Het
March7 T C 2: 60,229,084 probably null Het
Mast4 C T 13: 102,804,647 V301I probably damaging Het
Mlh3 T A 12: 85,235,720 N1412Y probably damaging Het
Mrps27 A G 13: 99,405,014 M209V probably benign Het
Mtor A T 4: 148,464,475 T572S probably benign Het
Neurog1 T C 13: 56,251,550 K128R probably damaging Het
Olfr124 T A 17: 37,805,863 N239K probably damaging Het
Olfr1484 A G 19: 13,585,447 I48V possibly damaging Het
Olfr981 T A 9: 40,022,600 L69* probably null Het
Pcdhgb1 A G 18: 37,681,599 K381R probably benign Het
Pdzd2 T C 15: 12,457,859 D306G probably damaging Het
Plekha5 C T 6: 140,543,908 T237I probably damaging Het
Pole A T 5: 110,332,499 I103F probably damaging Het
Ppfia2 A T 10: 106,474,854 Q74L possibly damaging Het
Ppm1d T C 11: 85,332,352 F261S probably damaging Het
Psg21 A T 7: 18,654,743 probably null Het
Ptprg T A 14: 11,962,602 F133L probably damaging Het
Rom1 G A 19: 8,929,205 probably benign Het
Rtn3 A G 19: 7,435,124 F762L probably damaging Het
Sec23ip T C 7: 128,765,440 S600P probably benign Het
Sema4b T A 7: 80,220,152 I396N probably damaging Het
Serpina3k T A 12: 104,341,107 D199E probably benign Het
Slc19a1 A G 10: 77,049,706 D480G possibly damaging Het
Slc8b1 G A 5: 120,527,815 V404M probably damaging Het
Slco1a4 T C 6: 141,819,604 D304G probably benign Het
Smpdl3b G T 4: 132,745,141 A107D possibly damaging Het
Tesk1 A G 4: 43,447,006 T465A probably benign Het
Tmem245 A G 4: 56,937,940 F203L probably benign Het
Tnip1 T A 11: 54,918,716 I442F probably benign Het
Txnip A G 3: 96,559,123 K127R possibly damaging Het
Usp32 A C 11: 85,032,088 L172R probably damaging Het
Vmn2r66 A G 7: 85,005,228 S508P possibly damaging Het
Vwa5b2 T A 16: 20,598,202 Y550N probably damaging Het
Wdr81 G A 11: 75,451,786 A885V probably benign Het
Other mutations in Klhl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Klhl6 APN 16 19957062 missense probably benign 0.00
IGL01465:Klhl6 APN 16 19982822 missense probably damaging 0.98
IGL01831:Klhl6 APN 16 19953485 missense probably damaging 1.00
IGL01971:Klhl6 APN 16 19949526 missense probably damaging 0.99
IGL02532:Klhl6 APN 16 19957082 missense possibly damaging 0.84
IGL03113:Klhl6 APN 16 19957251 missense possibly damaging 0.68
IGL03290:Klhl6 APN 16 19947137 missense probably benign 0.44
Ascension UTSW 16 19947098 missense probably damaging 1.00
besmirched UTSW 16 19949447 splice site probably null
blossom UTSW 16 19957139 missense probably damaging 1.00
cerulean UTSW 16 19957218 nonsense probably null
heights UTSW 16 19957028 missense probably damaging 0.98
Lazuli UTSW 16 19956966 frame shift probably null
Parula UTSW 16 19957043 missense possibly damaging 0.56
torres_del_paine UTSW 16 19948127 missense probably damaging 1.00
IGL03046:Klhl6 UTSW 16 19982889 missense probably benign
R0265:Klhl6 UTSW 16 19948234 missense probably benign 0.43
R0496:Klhl6 UTSW 16 19956966 frame shift probably null
R0497:Klhl6 UTSW 16 19956966 frame shift probably null
R0540:Klhl6 UTSW 16 19957014 missense possibly damaging 0.95
R0541:Klhl6 UTSW 16 19949447 splice site probably null
R0554:Klhl6 UTSW 16 19953593 missense probably damaging 0.96
R0607:Klhl6 UTSW 16 19957014 missense possibly damaging 0.95
R0636:Klhl6 UTSW 16 19948073 splice site probably benign
R0670:Klhl6 UTSW 16 19949559 missense possibly damaging 0.92
R1477:Klhl6 UTSW 16 19965977 missense probably benign 0.00
R1510:Klhl6 UTSW 16 19947098 missense probably damaging 1.00
R1547:Klhl6 UTSW 16 19966082 missense probably benign
R1747:Klhl6 UTSW 16 19947028 missense probably benign 0.40
R1871:Klhl6 UTSW 16 19957043 missense possibly damaging 0.56
R1966:Klhl6 UTSW 16 19982822 missense probably damaging 0.98
R2058:Klhl6 UTSW 16 19982931 missense probably benign
R4466:Klhl6 UTSW 16 19957268 missense probably damaging 0.99
R4645:Klhl6 UTSW 16 19947147 missense probably damaging 1.00
R4690:Klhl6 UTSW 16 19957284 missense probably benign 0.44
R4824:Klhl6 UTSW 16 19957028 missense probably damaging 0.98
R4833:Klhl6 UTSW 16 19957139 missense probably damaging 1.00
R4835:Klhl6 UTSW 16 19957033 missense probably benign 0.07
R5001:Klhl6 UTSW 16 19946991 makesense probably null
R5475:Klhl6 UTSW 16 19948127 missense probably damaging 1.00
R5700:Klhl6 UTSW 16 19957218 nonsense probably null
R5867:Klhl6 UTSW 16 19982820 missense probably benign 0.37
R5910:Klhl6 UTSW 16 19957094 missense probably benign 0.04
R7082:Klhl6 UTSW 16 19982883 missense probably benign 0.00
R7262:Klhl6 UTSW 16 19982796 missense probably damaging 1.00
R7314:Klhl6 UTSW 16 19957005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAGGGAAGTGCTTTAGTGC -3'
(R):5'- TCCAGGAGTTTAGGTTTCAGAC -3'

Sequencing Primer
(F):5'- GAAGTGCTTTAGTGCTAGCCTCC -3'
(R):5'- GTACCTATTACACAGTAGGCCCTGG -3'
Posted On2019-05-13