Mutagenetix > Incidental Mutation

Incidental Mutation 'R6871:Pax5'

543658

Institutional Source

Beutler Lab

Gene Symbol

Pax5

Ensembl Gene

ENSMUSG00000014030

Gene Name

paired box 5

Synonyms

EBB-1, Pax-5

MMRRC Submission

044968-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6871 (G1) of strain 613

Quality Score

95.0077

Status

Validated

Chromosome

Chromosomal Location

44524757-44710487 bp(-) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to A at 44710583 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014174] [ENSMUST00000102932] [ENSMUST00000107825] [ENSMUST00000107826] [ENSMUST00000107827] [ENSMUST00000134968] [ENSMUST00000143235] [ENSMUST00000165417] [ENSMUST00000173733] [ENSMUST00000173821] [ENSMUST00000174242]

AlphaFold

Q02650

Predicted Effect

probably benign
Transcript: ENSMUST00000014174
AA Change: -1

SMART Domains

Protein: ENSMUSP00000014174
Gene: ENSMUSG00000014030
AA Change: -1

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
low complexity region	157	189	N/A	INTRINSIC
SCOP:d1ftt__	220	254	1e-4	SMART
Pfam:Pax2_C	279	390	6e-53	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102932

SMART Domains

Protein: ENSMUSP00000099996
Gene: ENSMUSG00000014030

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
low complexity region	157	189	N/A	INTRINSIC
SCOP:d1ftt__	220	254	1e-4	SMART
Pfam:Pax2_C	276	341	1.1e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107825

SMART Domains

Protein: ENSMUSP00000103455
Gene: ENSMUSG00000014030

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
low complexity region	157	189	N/A	INTRINSIC
SCOP:d1ftt__	220	254	2e-4	SMART
Pfam:Pax2_C	279	356	5.7e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107826

SMART Domains

Protein: ENSMUSP00000103457
Gene: ENSMUSG00000014030

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
low complexity region	157	189	N/A	INTRINSIC
SCOP:d1ftt__	220	254	7e-4	SMART
low complexity region	269	281	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107827

SMART Domains

Protein: ENSMUSP00000103458
Gene: ENSMUSG00000014030

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
low complexity region	157	189	N/A	INTRINSIC
SCOP:d1ftt__	220	254	4e-4	SMART
low complexity region	298	310	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000134968

SMART Domains

Protein: ENSMUSP00000133540
Gene: ENSMUSG00000014030

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
SCOP:d1ftt__	177	211	1e-4	SMART
Pfam:Pax2_C	233	298	2.4e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000143235

SMART Domains

Protein: ENSMUSP00000134370
Gene: ENSMUSG00000014030

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
low complexity region	157	189	N/A	INTRINSIC
SCOP:d1ftt__	220	254	1e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165417

SMART Domains

Protein: ENSMUSP00000128880
Gene: ENSMUSG00000014030

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
SCOP:d1ftt__	177	211	1e-4	SMART
Pfam:Pax2_C	233	347	7.3e-55	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172866

SMART Domains

Protein: ENSMUSP00000134119
Gene: ENSMUSG00000014030

Domain	Start	End	E-Value	Type
PAX	4	85	2.44e-27	SMART
low complexity region	102	134	N/A	INTRINSIC
SCOP:d1ftt__	165	199	7e-5	SMART
Pfam:Pax2_C	224	335	2.3e-53	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173733

SMART Domains

Protein: ENSMUSP00000133671
Gene: ENSMUSG00000014030

Domain	Start	End	E-Value	Type
PAX	16	120	2.93e-30	SMART
SCOP:d1ftt__	154	188	1e-4	SMART
Pfam:Pax2_C	212	290	8.7e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000173821

SMART Domains

Protein: ENSMUSP00000134712
Gene: ENSMUSG00000014030

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
low complexity region	157	189	N/A	INTRINSIC
SCOP:d1ftt__	220	254	2e-4	SMART
low complexity region	306	325	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174242

SMART Domains

Protein: ENSMUSP00000134391
Gene: ENSMUSG00000014030

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
low complexity region	157	189	N/A	INTRINSIC
SCOP:d1ftt__	220	254	2e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174319

SMART Domains

Protein: ENSMUSP00000133978
Gene: ENSMUSG00000014030

Domain	Start	End	E-Value	Type
PAX	4	85	2.44e-27	SMART
low complexity region	102	134	N/A	INTRINSIC
SCOP:d1ftt__	165	199	2e-4	SMART
low complexity region	251	270	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

100% (16/16)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the paired box (PAX) family of transcription factors. The central feature of this gene family is a novel, highly conserved DNA-binding motif, known as the paired box. Paired box transcription factors are important regulators in early development, and alterations in the expression of their genes are thought to contribute to neoplastic transformation. This gene encodes the B-cell lineage specific activator protein that is expressed at early, but not late stages of B-cell differentiation. Its expression has also been detected in developing CNS and testis and so the encoded protein may also play a role in neural development and spermatogenesis. This gene is located at 9p13, which is involved in t(9;14)(p13;q32) translocations recurring in small lymphocytic lymphomas of the plasmacytoid subtype, and in derived large-cell lymphomas. This translocation brings the potent E-mu enhancer of the IgH gene into close proximity of the PAX5 promoter, suggesting that the deregulation of transcription of this gene contributes to the pathogenesis of these lymphomas. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Null mutants exhibit impaired development of the midbrain resulting in a reduced inferior colliculus and an altered cerebellar folial pattern, failure of B cell differentiation, runting, and high postnatal mortality with few survivors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 9 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arsi	G	A	18: 61,049,723 (GRCm39)	G202E	probably benign	Het
Cntn6	GAATCA	GAATCAATCA	6: 104,822,719 (GRCm39)		probably null	Het
Dnah5	C	A	15: 28,229,786 (GRCm39)	T140K	probably benign	Het
Itih3	T	C	14: 30,634,644 (GRCm39)	N121S	probably benign	Het
Lgr6	C	T	1: 134,921,748 (GRCm39)	A199T	probably damaging	Het
Lrch1	A	G	14: 75,049,063 (GRCm39)	S395P	probably benign	Het
Piezo1	G	A	8: 123,211,766 (GRCm39)		probably null	Het
Top2b	T	G	14: 16,409,189 (GRCm38)	I777M	probably damaging	Het
Zfp1006	A	C	8: 129,960,881 (GRCm39)		probably null	Het

Other mutations in Pax5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02369:Pax5	APN	4	44,691,919 (GRCm39)	missense	probably damaging	1.00
IGL02700:Pax5	APN	4	44,682,722 (GRCm39)	missense	probably damaging	0.99
IGL02754:Pax5	APN	4	44,570,059 (GRCm39)	missense	probably damaging	0.96
apple	UTSW	4	0 ()	unclassified
Denim	UTSW	4	44,645,661 (GRCm39)	nonsense	probably null
Glacier	UTSW	4	44,679,494 (GRCm39)	missense	probably damaging	1.00
glacier2	UTSW	4	44,710,407 (GRCm39)	start codon destroyed	probably null	0.96
Glacier3	UTSW	4	44,679,526 (GRCm39)	missense	probably damaging	1.00
jeans	UTSW	4	44,645,621 (GRCm39)	missense	probably benign	0.03
k2	UTSW	4	44,697,630 (GRCm39)	missense	probably damaging	1.00
menshevik	UTSW	4	44,570,071 (GRCm39)	missense	probably damaging	1.00
Son_of_apple	UTSW	4	44,710,583 (GRCm39)	unclassified	probably benign
R0411:Pax5	UTSW	4	44,609,783 (GRCm39)	missense	probably damaging	0.99
R0415:Pax5	UTSW	4	44,691,886 (GRCm39)	missense	probably damaging	1.00
R0655:Pax5	UTSW	4	44,537,462 (GRCm39)	missense	probably damaging	0.97
R1146:Pax5	UTSW	4	44,697,512 (GRCm39)	splice site	probably benign
R1752:Pax5	UTSW	4	44,609,729 (GRCm39)	missense	probably damaging	1.00
R1891:Pax5	UTSW	4	44,691,859 (GRCm39)	missense	probably damaging	1.00
R4766:Pax5	UTSW	4	44,679,494 (GRCm39)	missense	probably damaging	1.00
R4783:Pax5	UTSW	4	44,570,086 (GRCm39)	missense	probably damaging	1.00
R5134:Pax5	UTSW	4	44,710,407 (GRCm39)	start codon destroyed	probably null	0.96
R5341:Pax5	UTSW	4	44,697,630 (GRCm39)	missense	probably damaging	1.00
R5458:Pax5	UTSW	4	44,679,526 (GRCm39)	missense	probably damaging	1.00
R6281:Pax5	UTSW	4	44,691,955 (GRCm39)	missense	probably benign	0.37
R7025:Pax5	UTSW	4	44,679,501 (GRCm39)	nonsense	probably null
R7204:Pax5	UTSW	4	44,679,485 (GRCm39)	missense	possibly damaging	0.93
R7975:Pax5	UTSW	4	44,537,465 (GRCm39)	missense	probably damaging	0.98
R8246:Pax5	UTSW	4	44,570,027 (GRCm39)	missense	probably benign	0.08
R8527:Pax5	UTSW	4	44,570,071 (GRCm39)	missense	probably damaging	1.00
R8542:Pax5	UTSW	4	44,570,071 (GRCm39)	missense	probably damaging	1.00
R8836:Pax5	UTSW	4	44,645,621 (GRCm39)	missense	probably benign	0.03
R8847:Pax5	UTSW	4	44,691,865 (GRCm39)	missense	probably benign	0.15
R8987:Pax5	UTSW	4	44,645,661 (GRCm39)	nonsense	probably null
R9404:Pax5	UTSW	4	44,645,565 (GRCm39)	missense	possibly damaging	0.80
S24628:Pax5	UTSW	4	44,691,886 (GRCm39)	missense	probably damaging	1.00
X0018:Pax5	UTSW	4	44,691,880 (GRCm39)	missense	probably damaging	1.00
Z1176:Pax5	UTSW	4	44,697,678 (GRCm39)	missense	probably damaging	1.00
Z1177:Pax5	UTSW	4	44,697,558 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGTTCCTACCTGTCCTGATG -3'
(R):5'- AATCATTTCACGGTGCCTTCG -3'

Sequencing Primer
(F):5'- TACCTGTCCTGATGGTCCGAG -3'
(R):5'- ACGGTGCCTTCGGACGC -3'

Posted On

2019-04-30