Mutagenetix > Incidental Mutation

Incidental Mutation 'R6371:Son'

531220

Institutional Source

Beutler Lab

Gene Symbol

Son

Ensembl Gene

ENSMUSG00000022961

Gene Name

Son DNA binding protein

Synonyms

2900011L12Rik

MMRRC Submission

044521-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.950) question?

Stock #

R6371 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

91444712-91476080 bp(+) (GRCm39)

Type of Mutation

DNA Base Change (assembly)

T to C at 91471629 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

Q9QX47

Coding Region Coverage

1x: 100.0%
3x: 99.7%
10x: 98.2%
20x: 94.1%

Validation Efficiency

98% (50/51)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam6b	C	T	12: 113,453,894 (GRCm39)	S237L	probably damaging	Het
Ank3	T	G	10: 69,644,709 (GRCm39)	L58V	probably damaging	Het
Arsb	A	T	13: 93,926,574 (GRCm39)	I115F	possibly damaging	Het
Atad2b	T	C	12: 5,023,970 (GRCm39)	Y32H	probably damaging	Het
Brd1	A	C	15: 88,598,201 (GRCm39)	M515R	probably benign	Het
Cbx7	A	G	15: 79,803,023 (GRCm39)	S30P	possibly damaging	Het
Cdk12	A	G	11: 98,136,114 (GRCm39)	T1123A	unknown	Het
Cep170b	A	G	12: 112,707,379 (GRCm39)	D375G	probably damaging	Het
Clcn3	T	C	8: 61,390,369 (GRCm39)	K164E	probably benign	Het
Clip4	A	C	17: 72,163,459 (GRCm39)	K677T	probably damaging	Het
Clrn2	T	C	5: 45,617,540 (GRCm39)	I137T	possibly damaging	Het
Cntln	T	C	4: 84,802,816 (GRCm39)	S39P	probably damaging	Het
Crocc2	T	A	1: 93,143,353 (GRCm39)	N1318K	probably benign	Het
Emc1	C	T	4: 139,098,976 (GRCm39)	Q820*	probably null	Het
Fbxl2	G	A	9: 113,818,451 (GRCm39)	T170I	probably damaging	Het
Fyb2	A	G	4: 104,852,975 (GRCm39)	T552A	probably damaging	Het
Garin5b	A	G	7: 4,762,358 (GRCm39)	V257A	probably benign	Het
Gm2381	G	A	7: 42,470,010 (GRCm39)	A38V	probably benign	Het
Gpt2	G	A	8: 86,244,681 (GRCm39)	E325K	probably benign	Het
Helz2	C	T	2: 180,875,260 (GRCm39)	E1745K	probably damaging	Het
Hspg2	T	C	4: 137,269,006 (GRCm39)	Y2213H	probably damaging	Het
Ifnar2	T	C	16: 91,184,986 (GRCm39)	Y24H	possibly damaging	Het
Inpp5d	T	A	1: 87,627,397 (GRCm39)	L566Q	probably damaging	Het
Itgb2	C	A	10: 77,384,431 (GRCm39)	P184H	probably damaging	Het
Kcnb2	T	A	1: 15,781,436 (GRCm39)	D769E	probably benign	Het
Lrp1b	A	G	2: 40,741,666 (GRCm39)	M3087T	possibly damaging	Het
Ltbp3	A	G	19: 5,795,800 (GRCm39)		probably null	Het
Ms4a6b	A	G	19: 11,497,728 (GRCm39)	E9G	probably damaging	Het
Nat3	G	A	8: 67,976,831 (GRCm39)		probably null	Het
Ndufaf1	A	T	2: 119,490,534 (GRCm39)	D175E	probably damaging	Het
Nop58	T	G	1: 59,750,471 (GRCm39)		probably benign	Het
Or10al6	A	G	17: 38,083,326 (GRCm39)	T261A	probably benign	Het
Or8s16	A	G	15: 98,211,219 (GRCm39)	Y71H	possibly damaging	Het
P3h4	C	T	11: 100,302,575 (GRCm39)	E354K	probably benign	Het
Plekhm2	T	G	4: 141,356,843 (GRCm39)	T787P	possibly damaging	Het
Ppia	C	T	11: 6,368,230 (GRCm39)	T37I	probably benign	Het
Reln	T	A	5: 22,200,511 (GRCm39)	M1330L	probably benign	Het
Ric1	A	G	19: 29,539,426 (GRCm39)	E53G	probably benign	Het
Sgip1	T	A	4: 102,823,482 (GRCm39)	V721E	probably damaging	Het
Slc33a1	A	T	3: 63,850,709 (GRCm39)	D538E	probably benign	Het
Srebf1	A	T	11: 60,094,341 (GRCm39)	S591R	probably damaging	Het
St3gal1	A	G	15: 66,983,195 (GRCm39)	V187A	possibly damaging	Het
Taok2	G	A	7: 126,469,319 (GRCm39)	R1170W	probably damaging	Het
Tsc2	A	T	17: 24,845,688 (GRCm39)	V210E	probably benign	Het
Ttc6	T	A	12: 57,775,249 (GRCm39)	N1648K	possibly damaging	Het
Vgll3	C	T	16: 65,636,131 (GRCm39)	P94L	probably damaging	Het
Vmn2r54	A	T	7: 12,349,362 (GRCm39)	V740E	probably damaging	Het
Yeats2	A	G	16: 20,040,460 (GRCm39)	E1127G	possibly damaging	Het
Zfp709	T	A	8: 72,643,329 (GRCm39)	Y252N	probably damaging	Het

Other mutations in Son

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00531:Son	APN	16	91,461,210 (GRCm39)	missense	probably damaging	0.99
IGL01024:Son	APN	16	91,452,798 (GRCm39)	missense	probably damaging	1.00
IGL01066:Son	APN	16	91,457,024 (GRCm39)	intron	probably benign
IGL01083:Son	APN	16	91,454,279 (GRCm39)	missense	probably damaging	1.00
IGL01115:Son	APN	16	91,456,346 (GRCm39)	missense	probably benign	0.31
IGL01467:Son	APN	16	91,454,165 (GRCm39)	missense	possibly damaging	0.93
IGL01506:Son	APN	16	91,454,174 (GRCm39)	missense	possibly damaging	0.67
IGL01933:Son	APN	16	91,454,903 (GRCm39)	missense	probably benign	0.00
IGL02156:Son	APN	16	91,452,992 (GRCm39)	missense	possibly damaging	0.93
IGL02473:Son	APN	16	91,455,683 (GRCm39)	missense	probably damaging	0.99
IGL02498:Son	APN	16	91,453,713 (GRCm39)	missense	probably damaging	0.99
IGL02517:Son	APN	16	91,452,099 (GRCm39)	missense	possibly damaging	0.92
IGL02530:Son	APN	16	91,455,359 (GRCm39)	missense	possibly damaging	0.50
IGL02865:Son	APN	16	91,448,640 (GRCm39)	missense	probably damaging	1.00
IGL03180:Son	APN	16	91,453,896 (GRCm39)	missense	probably damaging	1.00
R0013:Son	UTSW	16	91,448,550 (GRCm39)	missense	probably damaging	1.00
R0036:Son	UTSW	16	91,457,054 (GRCm39)	intron	probably benign
R0037:Son	UTSW	16	91,461,616 (GRCm39)	missense	probably damaging	1.00
R0041:Son	UTSW	16	91,456,221 (GRCm39)	missense	probably damaging	1.00
R0048:Son	UTSW	16	91,455,865 (GRCm39)	missense	possibly damaging	0.94
R0048:Son	UTSW	16	91,455,865 (GRCm39)	missense	possibly damaging	0.94
R0056:Son	UTSW	16	91,475,043 (GRCm39)	missense	possibly damaging	0.86
R0227:Son	UTSW	16	91,453,761 (GRCm39)	missense	probably damaging	0.99
R0256:Son	UTSW	16	91,453,472 (GRCm39)	missense	possibly damaging	0.95
R0302:Son	UTSW	16	91,453,032 (GRCm39)	missense	probably damaging	1.00
R0815:Son	UTSW	16	91,452,372 (GRCm39)	missense	probably damaging	0.98
R1225:Son	UTSW	16	91,454,228 (GRCm39)	missense	probably damaging	1.00
R1255:Son	UTSW	16	91,461,583 (GRCm39)	missense	probably damaging	1.00
R1457:Son	UTSW	16	91,453,974 (GRCm39)	missense	probably damaging	1.00
R1459:Son	UTSW	16	91,452,230 (GRCm39)	missense	possibly damaging	0.93
R1535:Son	UTSW	16	91,456,622 (GRCm39)	missense	probably damaging	0.99
R1587:Son	UTSW	16	91,456,606 (GRCm39)	missense	probably damaging	1.00
R1605:Son	UTSW	16	91,454,552 (GRCm39)	missense	probably damaging	1.00
R1629:Son	UTSW	16	91,454,510 (GRCm39)	missense	probably damaging	1.00
R1711:Son	UTSW	16	91,457,114 (GRCm39)	intron	probably benign
R2138:Son	UTSW	16	91,456,260 (GRCm39)	missense	possibly damaging	0.95
R2245:Son	UTSW	16	91,444,848 (GRCm39)	splice site	probably null
R2351:Son	UTSW	16	91,454,547 (GRCm39)	missense	probably damaging	0.98
R2434:Son	UTSW	16	91,451,575 (GRCm39)	missense	probably damaging	1.00
R2870:Son	UTSW	16	91,461,205 (GRCm39)	splice site	probably null
R2871:Son	UTSW	16	91,461,205 (GRCm39)	splice site	probably null
R2872:Son	UTSW	16	91,461,205 (GRCm39)	splice site	probably null
R2889:Son	UTSW	16	91,456,787 (GRCm39)	unclassified	probably benign
R3712:Son	UTSW	16	91,453,614 (GRCm39)	missense	probably damaging	0.99
R3913:Son	UTSW	16	91,456,999 (GRCm39)	intron	probably benign
R4172:Son	UTSW	16	91,456,250 (GRCm39)	missense	probably damaging	1.00
R4301:Son	UTSW	16	91,455,299 (GRCm39)	missense	possibly damaging	0.53
R4302:Son	UTSW	16	91,455,299 (GRCm39)	missense	possibly damaging	0.53
R4770:Son	UTSW	16	91,455,756 (GRCm39)	missense	probably damaging	0.96
R4881:Son	UTSW	16	91,472,397 (GRCm39)	missense	probably benign	0.31
R5020:Son	UTSW	16	91,453,263 (GRCm39)	missense	probably damaging	1.00
R5032:Son	UTSW	16	91,454,552 (GRCm39)	missense	probably damaging	1.00
R5151:Son	UTSW	16	91,452,587 (GRCm39)	missense	probably damaging	1.00
R5153:Son	UTSW	16	91,451,910 (GRCm39)	missense	possibly damaging	0.86
R5215:Son	UTSW	16	91,453,563 (GRCm39)	missense	probably damaging	0.99
R5243:Son	UTSW	16	91,451,621 (GRCm39)	missense	probably damaging	1.00
R5354:Son	UTSW	16	91,452,627 (GRCm39)	missense	probably damaging	0.99
R5529:Son	UTSW	16	91,452,354 (GRCm39)	missense	probably damaging	1.00
R5696:Son	UTSW	16	91,468,301 (GRCm39)	missense	possibly damaging	0.67
R5763:Son	UTSW	16	91,454,378 (GRCm39)	missense	probably damaging	1.00
R5766:Son	UTSW	16	91,461,875 (GRCm39)	intron	probably benign
R5788:Son	UTSW	16	91,456,940 (GRCm39)	intron	probably benign
R5992:Son	UTSW	16	91,455,792 (GRCm39)	missense	probably benign	0.04
R6314:Son	UTSW	16	91,457,298 (GRCm39)	intron	probably benign
R6429:Son	UTSW	16	91,455,054 (GRCm39)	missense	probably benign	0.33
R6451:Son	UTSW	16	91,454,490 (GRCm39)	missense	probably damaging	0.99
R6489:Son	UTSW	16	91,452,044 (GRCm39)	missense	possibly damaging	0.70
R6513:Son	UTSW	16	91,456,835 (GRCm39)	intron	probably benign
R6753:Son	UTSW	16	91,454,076 (GRCm39)	missense	probably damaging	0.99
R6916:Son	UTSW	16	91,451,673 (GRCm39)	missense	probably damaging	0.97
R7070:Son	UTSW	16	91,453,729 (GRCm39)	unclassified	probably benign
R7079:Son	UTSW	16	91,453,729 (GRCm39)	unclassified	probably benign
R7110:Son	UTSW	16	91,453,406 (GRCm39)	missense	probably benign	0.01
R7120:Son	UTSW	16	91,467,414 (GRCm39)	missense	unknown
R7120:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R7167:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7205:Son	UTSW	16	91,457,183 (GRCm39)	small deletion	probably benign
R7208:Son	UTSW	16	91,458,990 (GRCm39)	missense	unknown
R7219:Son	UTSW	16	91,461,889 (GRCm39)	missense	unknown
R7249:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7328:Son	UTSW	16	91,455,278 (GRCm39)	missense	probably benign	0.33
R7330:Son	UTSW	16	91,453,486 (GRCm39)	unclassified	probably benign
R7374:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7405:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R7420:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7424:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7464:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R7514:Son	UTSW	16	91,451,748 (GRCm39)	missense	probably damaging	0.99
R7555:Son	UTSW	16	91,455,810 (GRCm39)	missense	probably damaging	0.99
R7645:Son	UTSW	16	91,457,183 (GRCm39)	small deletion	probably benign
R7716:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R7718:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7778:Son	UTSW	16	91,453,416 (GRCm39)	missense	probably damaging	0.99
R7824:Son	UTSW	16	91,453,416 (GRCm39)	missense	probably damaging	0.99
R7856:Son	UTSW	16	91,456,146 (GRCm39)	missense	probably damaging	0.99
R7870:Son	UTSW	16	91,453,486 (GRCm39)	unclassified	probably benign
R7928:Son	UTSW	16	91,453,729 (GRCm39)	unclassified	probably benign
R7972:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7978:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8000:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8192:Son	UTSW	16	91,452,437 (GRCm39)	missense	possibly damaging	0.91
R8221:Son	UTSW	16	91,453,734 (GRCm39)	missense	probably damaging	1.00
R8227:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R8233:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8255:Son	UTSW	16	91,461,824 (GRCm39)	missense	unknown
R8292:Son	UTSW	16	91,453,545 (GRCm39)	missense	possibly damaging	0.93
R8407:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8468:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R8495:Son	UTSW	16	91,457,183 (GRCm39)	small deletion	probably benign
R8772:Son	UTSW	16	91,454,826 (GRCm39)	missense	possibly damaging	0.65
R8796:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8862:Son	UTSW	16	91,453,734 (GRCm39)	missense	probably damaging	1.00
R8962:Son	UTSW	16	91,455,057 (GRCm39)	missense	possibly damaging	0.91
R8972:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8991:Son	UTSW	16	91,453,608 (GRCm39)	missense	possibly damaging	0.95
R8991:Son	UTSW	16	91,453,366 (GRCm39)	missense	probably benign	0.04
R9086:Son	UTSW	16	91,467,418 (GRCm39)	missense	unknown
R9138:Son	UTSW	16	91,452,006 (GRCm39)	missense	possibly damaging	0.80
R9232:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R9241:Son	UTSW	16	91,454,122 (GRCm39)	missense	probably damaging	0.96
R9258:Son	UTSW	16	91,474,570 (GRCm39)	missense	unknown
R9328:Son	UTSW	16	91,452,645 (GRCm39)	missense	possibly damaging	0.67
R9420:Son	UTSW	16	91,454,508 (GRCm39)	missense	probably damaging	0.98
R9468:Son	UTSW	16	91,454,439 (GRCm39)	missense	possibly damaging	0.53
R9500:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R9516:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R9595:Son	UTSW	16	91,454,241 (GRCm39)	missense	possibly damaging	0.73
R9679:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R9719:Son	UTSW	16	91,456,440 (GRCm39)	missense	probably damaging	0.96
R9749:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R9772:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R9782:Son	UTSW	16	91,444,838 (GRCm39)	missense	probably damaging	0.99
R9788:Son	UTSW	16	91,453,699 (GRCm39)	unclassified	probably benign
RF007:Son	UTSW	16	91,456,257 (GRCm39)	missense	possibly damaging	0.53
RF041:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
Z1176:Son	UTSW	16	91,452,689 (GRCm39)	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- ACAGTTGTGCAGCTTAGGAC -3'
(R):5'- TCCCCACTCTATTATAAGGCAAG -3'

Sequencing Primer
(F):5'- CAGTTGTGCAGCTTAGGACATTAAG -3'
(R):5'- GCACATGAAACACCCTGTA -3'

Posted On

2018-08-06