Incidental Mutation 'R6690:Prkcb'
ID 530381
Institutional Source Beutler Lab
Gene Symbol Prkcb
Ensembl Gene ENSMUSG00000052889
Gene Name protein kinase C, beta
Synonyms Prkcb1, A130082F03Rik, Prkcb2, Pkcb, PKC-Beta
MMRRC Submission 044808-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6690 (G1)
Quality Score 110.008
Status Not validated
Chromosome 7
Chromosomal Location 121888327-122233625 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121888737 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 57 (I57T)
Ref Sequence ENSEMBL: ENSMUSP00000138788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064921] [ENSMUST00000064989] [ENSMUST00000143692]
AlphaFold P68404
Predicted Effect probably damaging
Transcript: ENSMUST00000064921
AA Change: I57T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000064812
Gene: ENSMUSG00000052889
AA Change: I57T

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 664 9.86e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000064989
AA Change: I57T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000070019
Gene: ENSMUSG00000052889
AA Change: I57T

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131167
Predicted Effect probably damaging
Transcript: ENSMUST00000143692
AA Change: I57T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138788
Gene: ENSMUSG00000052889
AA Change: I57T

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Meta Mutation Damage Score 0.7720 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired humoral immune responses, altered proliferative responses of B cells to various stimuli, abnormal vascular wound healing, and deficits in contextual and cued fear conditioning. ENU-induced mutations leadto impaired T cell-independent IgM responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,115,062 (GRCm39) G628D probably damaging Het
Ahnak G T 19: 8,986,945 (GRCm39) G2743V probably benign Het
Akr1c14 A T 13: 4,113,713 (GRCm39) T82S possibly damaging Het
Ccdc7b A G 8: 129,904,700 (GRCm39) T113A probably benign Het
Cep152 A T 2: 125,406,290 (GRCm39) L1414Q probably damaging Het
Chd8 T C 14: 52,464,694 (GRCm39) E658G possibly damaging Het
Clca3a1 G C 3: 144,719,644 (GRCm39) A442G probably damaging Het
Coro6 A G 11: 77,356,606 (GRCm39) T105A probably benign Het
Cux1 A G 5: 136,368,971 (GRCm39) I232T probably damaging Het
Dmrt1 A G 19: 25,523,449 (GRCm39) T267A probably benign Het
Fam149a G T 8: 45,802,071 (GRCm39) A387E probably damaging Het
Fat4 G A 3: 39,037,688 (GRCm39) G3780D probably damaging Het
Igf2r A T 17: 12,910,824 (GRCm39) L1998* probably null Het
Iqcf6 C T 9: 106,504,501 (GRCm39) T55I possibly damaging Het
Mterf3 G A 13: 67,065,110 (GRCm39) L264F probably damaging Het
Or10k2 G T 8: 84,267,904 (GRCm39) V44L probably benign Het
Or8g32 A G 9: 39,305,845 (GRCm39) I253V probably benign Het
Pcdhgb7 A T 18: 37,886,050 (GRCm39) I407F probably benign Het
Pip4k2b T C 11: 97,620,393 (GRCm39) D114G probably damaging Het
Plbd1 G T 6: 136,612,598 (GRCm39) N198K probably damaging Het
Ralgapa1 C T 12: 55,769,558 (GRCm39) probably null Het
Slc26a8 A G 17: 28,863,629 (GRCm39) I710T possibly damaging Het
Smc2 A T 4: 52,449,375 (GRCm39) I179L probably benign Het
Tmub2 C T 11: 102,178,345 (GRCm39) H83Y probably damaging Het
Trip11 C A 12: 101,851,710 (GRCm39) D785Y possibly damaging Het
Vill A G 9: 118,890,975 (GRCm39) T194A probably benign Het
Vmn2r59 T C 7: 41,695,890 (GRCm39) D174G probably damaging Het
Other mutations in Prkcb
AlleleSourceChrCoordTypePredicted EffectPPH Score
tilcara APN 7 122,194,228 (GRCm39) missense probably damaging 1.00
IGL02045:Prkcb APN 7 122,189,390 (GRCm39) missense probably damaging 1.00
IGL02273:Prkcb APN 7 122,226,990 (GRCm39) missense probably damaging 1.00
IGL02638:Prkcb APN 7 122,200,063 (GRCm39) splice site probably benign
IGL02962:Prkcb APN 7 122,024,270 (GRCm39) splice site probably null
IGL03013:Prkcb APN 7 122,226,905 (GRCm39) missense probably damaging 1.00
IGL03224:Prkcb APN 7 122,116,147 (GRCm39) nonsense probably null
Almonde UTSW 7 122,181,672 (GRCm39) missense probably damaging 1.00
Baghdad UTSW 7 122,226,886 (GRCm39) missense probably benign 0.07
Mesopotamia UTSW 7 121,888,737 (GRCm39) missense probably damaging 1.00
Mosul UTSW 7 122,116,067 (GRCm39) missense probably damaging 1.00
tigris UTSW 7 122,024,200 (GRCm39) missense probably damaging 1.00
Tikrit UTSW 7 122,226,916 (GRCm39) missense probably damaging 1.00
untied UTSW 7 122,181,662 (GRCm39) missense possibly damaging 0.90
F5770:Prkcb UTSW 7 122,127,699 (GRCm39) missense probably damaging 0.99
R0078:Prkcb UTSW 7 122,189,393 (GRCm39) missense probably damaging 1.00
R0409:Prkcb UTSW 7 122,024,200 (GRCm39) missense probably damaging 1.00
R0660:Prkcb UTSW 7 122,024,182 (GRCm39) missense possibly damaging 0.56
R1462:Prkcb UTSW 7 122,181,672 (GRCm39) missense probably damaging 1.00
R1462:Prkcb UTSW 7 122,181,672 (GRCm39) missense probably damaging 1.00
R1480:Prkcb UTSW 7 122,193,865 (GRCm39) missense probably damaging 1.00
R1518:Prkcb UTSW 7 122,143,854 (GRCm39) critical splice acceptor site probably null
R1540:Prkcb UTSW 7 122,226,916 (GRCm39) missense probably damaging 1.00
R1860:Prkcb UTSW 7 122,167,424 (GRCm39) missense probably damaging 1.00
R3110:Prkcb UTSW 7 122,116,079 (GRCm39) missense probably damaging 0.99
R3112:Prkcb UTSW 7 122,116,079 (GRCm39) missense probably damaging 0.99
R4583:Prkcb UTSW 7 122,056,447 (GRCm39) missense probably benign 0.32
R4847:Prkcb UTSW 7 122,167,372 (GRCm39) missense probably benign 0.35
R5220:Prkcb UTSW 7 121,888,678 (GRCm39) missense probably damaging 1.00
R5487:Prkcb UTSW 7 122,199,948 (GRCm39) nonsense probably null
R5599:Prkcb UTSW 7 122,181,701 (GRCm39) missense probably benign 0.17
R5946:Prkcb UTSW 7 122,143,926 (GRCm39) missense probably benign
R6257:Prkcb UTSW 7 122,167,386 (GRCm39) missense probably benign
R6590:Prkcb UTSW 7 121,888,737 (GRCm39) missense probably damaging 1.00
R6618:Prkcb UTSW 7 122,226,886 (GRCm39) missense probably benign 0.07
R6763:Prkcb UTSW 7 122,193,887 (GRCm39) missense probably damaging 1.00
R7289:Prkcb UTSW 7 122,143,910 (GRCm39) missense probably benign 0.04
R7414:Prkcb UTSW 7 122,167,450 (GRCm39) missense possibly damaging 0.83
R7466:Prkcb UTSW 7 122,116,067 (GRCm39) missense probably damaging 1.00
R7540:Prkcb UTSW 7 122,167,357 (GRCm39) missense probably damaging 0.99
R8283:Prkcb UTSW 7 122,199,948 (GRCm39) nonsense probably null
R9072:Prkcb UTSW 7 122,127,771 (GRCm39) missense probably benign 0.14
R9483:Prkcb UTSW 7 122,181,663 (GRCm39) missense probably damaging 0.99
R9670:Prkcb UTSW 7 122,233,070 (GRCm39) nonsense probably null
V7581:Prkcb UTSW 7 122,127,699 (GRCm39) missense probably damaging 0.99
X0061:Prkcb UTSW 7 122,056,529 (GRCm39) missense probably benign 0.03
Z1177:Prkcb UTSW 7 122,167,419 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTCATGCAAATGAGGGAGGC -3'
(R):5'- CTGAGCCAGGTGTCGAAAAG -3'

Sequencing Primer
(F):5'- TGCCAAGCACAGCTGGAC -3'
(R):5'- TGTCGAAAAGGCGCCTG -3'
Posted On 2018-08-01